Mutagenetix > Incidental Mutation

Incidental Mutation 'R4500:Pias3'

501801

Institutional Source

Beutler Lab

Gene Symbol

Pias3

Ensembl Gene

ENSMUSG00000028101

Gene Name

protein inhibitor of activated STAT 3

Synonyms

Pias3L

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.520) question?

Stock #

R4500 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96603700-96613386 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 96608734 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 259 (R259W)

Ref Sequence

ENSEMBL: ENSMUSP00000125747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029742] [ENSMUST00000064900] [ENSMUST00000107076] [ENSMUST00000107077] [ENSMUST00000162934] [ENSMUST00000176302] [ENSMUST00000171249] [ENSMUST00000162778] [ENSMUST00000200387]

AlphaFold

O54714

Predicted Effect

probably benign
Transcript: ENSMUST00000029742

SMART Domains

Protein: ENSMUSP00000029742
Gene: ENSMUSG00000028100

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
Pfam:NUDIX	92	252	2.2e-9	PFAM
low complexity region	273	288	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000064900
AA Change: R268W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000069259
Gene: ENSMUSG00000028101
AA Change: R268W

Domain	Start	End	E-Value	Type
SAP	11	45	3.75e-5	SMART
low complexity region	70	109	N/A	INTRINSIC
Pfam:PINIT	126	278	1.1e-38	PFAM
Pfam:zf-MIZ	323	372	1.7e-22	PFAM
low complexity region	608	617	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107076
AA Change: R259W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102691
Gene: ENSMUSG00000028101
AA Change: R259W

Domain	Start	End	E-Value	Type
SAP	2	36	3.75e-5	SMART
low complexity region	61	100	N/A	INTRINSIC
Pfam:PINIT	113	269	1.1e-45	PFAM
Pfam:zf-Nse	305	361	8e-7	PFAM
Pfam:zf-MIZ	314	363	2.2e-21	PFAM
low complexity region	599	608	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107077
AA Change: R233W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102692
Gene: ENSMUSG00000028101
AA Change: R233W

Domain	Start	End	E-Value	Type
SAP	11	45	3.75e-5	SMART
Pfam:PINIT	87	243	5.3e-46	PFAM
Pfam:zf-Nse	279	335	2.4e-7	PFAM
Pfam:zf-MIZ	288	337	7.4e-22	PFAM
low complexity region	573	582	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161296

Predicted Effect

probably benign
Transcript: ENSMUST00000162156

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162707

Predicted Effect

probably damaging
Transcript: ENSMUST00000162934
AA Change: R259W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125747
Gene: ENSMUSG00000028101
AA Change: R259W

Domain	Start	End	E-Value	Type
SAP	2	36	3.75e-5	SMART
low complexity region	61	100	N/A	INTRINSIC
Pfam:PINIT	113	269	1.3e-46	PFAM
Pfam:zf-Nse	305	361	7e-8	PFAM
Pfam:zf-MIZ	314	363	2.6e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176302

SMART Domains

Protein: ENSMUSP00000134835
Gene: ENSMUSG00000028101

Domain	Start	End	E-Value	Type
SAP	2	36	2.57e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171249

SMART Domains

Protein: ENSMUSP00000129851
Gene: ENSMUSG00000028100

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
Pfam:NUDIX	92	235	1.2e-18	PFAM
low complexity region	256	271	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196773

Predicted Effect

probably benign
Transcript: ENSMUST00000162778

SMART Domains

Protein: ENSMUSP00000125377
Gene: ENSMUSG00000028101

Domain	Start	End	E-Value	Type
SAP	2	36	3.75e-5	SMART
low complexity region	61	84	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176288

Predicted Effect

probably benign
Transcript: ENSMUST00000200387

SMART Domains

Protein: ENSMUSP00000142879
Gene: ENSMUSG00000028100

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:NUDIX	79	125	4.2e-6	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)] family of transcriptional modulators. The protein functions as a SUMO (small ubiquitin-like modifier)-E3 ligase which catalyzes the covalent attachment of a SUMO protein to specific target substrates. It directly binds to several transcription factors and either blocks or enhances their activity. Alternatively spliced transcript variants of this gene have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Double KO mice display a retinal phenotype reduced M-cone response at P21 and reduced S-cone and rod responses from 7 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310034C09Rik	T	A	16: 88,556,429 (GRCm39)	C214*	probably null	Het
Ap3s1	T	C	18: 46,923,067 (GRCm39)	V186A	possibly damaging	Het
Dennd4a	G	A	9: 64,817,405 (GRCm39)	D1680N	possibly damaging	Het
Dpep2	T	C	8: 106,712,114 (GRCm39)	E282G	probably benign	Het
Duxf4	C	T	10: 58,071,528 (GRCm39)	A229T	possibly damaging	Het
Fam83d	A	G	2: 158,627,187 (GRCm39)	E292G	probably benign	Het
Hook1	T	C	4: 95,881,437 (GRCm39)		probably null	Het
Iqca1l	T	C	5: 24,753,275 (GRCm39)	D459G	possibly damaging	Het
Klhl18	C	T	9: 110,259,034 (GRCm39)	G445S	probably damaging	Het
Or14a257	A	T	7: 86,138,127 (GRCm39)	C211S	probably benign	Het
Or51a43	A	G	7: 103,717,402 (GRCm39)	S279P	probably damaging	Het
Prr11	T	G	11: 86,989,533 (GRCm39)	K279N	possibly damaging	Het
Sugp1	T	C	8: 70,509,038 (GRCm39)	S104P	probably benign	Het
Tmem239	A	G	2: 130,249,077 (GRCm39)	Y145C	possibly damaging	Het
Uchl4	T	C	9: 64,143,163 (GRCm39)	F215L	possibly damaging	Het
Usp5	C	G	6: 124,799,593 (GRCm39)	K318N	possibly damaging	Het
Usp7	C	T	16: 8,513,759 (GRCm39)	E785K	possibly damaging	Het
Vmn2r66	G	A	7: 84,657,162 (GRCm39)	A81V	probably damaging	Het

Other mutations in Pias3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00958:Pias3	APN	3	96,606,738 (GRCm39)	splice site	probably benign
IGL01370:Pias3	APN	3	96,610,891 (GRCm39)	missense	probably damaging	0.96
IGL01806:Pias3	APN	3	96,611,073 (GRCm39)	missense	probably benign	0.02
IGL02533:Pias3	APN	3	96,606,932 (GRCm39)	missense	possibly damaging	0.71
IGL02998:Pias3	APN	3	96,609,495 (GRCm39)	missense	probably damaging	0.98
IGL03304:Pias3	APN	3	96,607,347 (GRCm39)	missense	possibly damaging	0.65
R0764:Pias3	UTSW	3	96,608,611 (GRCm39)	missense	probably damaging	1.00
R1611:Pias3	UTSW	3	96,607,013 (GRCm39)	splice site	probably null
R1697:Pias3	UTSW	3	96,609,541 (GRCm39)	missense	probably damaging	1.00
R1751:Pias3	UTSW	3	96,608,719 (GRCm39)	missense	probably damaging	1.00
R1767:Pias3	UTSW	3	96,608,719 (GRCm39)	missense	probably damaging	1.00
R2184:Pias3	UTSW	3	96,609,537 (GRCm39)	missense	possibly damaging	0.92
R2257:Pias3	UTSW	3	96,606,962 (GRCm39)	missense	probably benign	0.22
R2398:Pias3	UTSW	3	96,611,129 (GRCm39)	missense	probably benign	0.00
R2851:Pias3	UTSW	3	96,610,853 (GRCm39)	missense	possibly damaging	0.94
R3845:Pias3	UTSW	3	96,609,526 (GRCm39)	missense	probably benign	0.28
R4127:Pias3	UTSW	3	96,606,982 (GRCm39)	missense	probably damaging	0.97
R4628:Pias3	UTSW	3	96,607,136 (GRCm39)	missense	probably damaging	1.00
R5068:Pias3	UTSW	3	96,611,171 (GRCm39)	missense	probably damaging	0.98
R5108:Pias3	UTSW	3	96,612,253 (GRCm39)	missense	possibly damaging	0.88
R5477:Pias3	UTSW	3	96,612,319 (GRCm39)	missense	probably damaging	0.99
R5498:Pias3	UTSW	3	96,609,504 (GRCm39)	missense	possibly damaging	0.89
R6457:Pias3	UTSW	3	96,606,839 (GRCm39)	missense	possibly damaging	0.81
R6966:Pias3	UTSW	3	96,609,511 (GRCm39)	missense	probably damaging	0.99
R7235:Pias3	UTSW	3	96,611,679 (GRCm39)	missense	probably benign
R7538:Pias3	UTSW	3	96,609,534 (GRCm39)	missense	possibly damaging	0.91
R7552:Pias3	UTSW	3	96,608,701 (GRCm39)	frame shift	probably null
R8791:Pias3	UTSW	3	96,612,201 (GRCm39)	missense	probably benign	0.22
R8815:Pias3	UTSW	3	96,607,381 (GRCm39)	missense	probably damaging	0.98
R9197:Pias3	UTSW	3	96,611,064 (GRCm39)	missense	probably benign	0.36
R9565:Pias3	UTSW	3	96,610,867 (GRCm39)	missense	possibly damaging	0.86
R9798:Pias3	UTSW	3	96,606,881 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTAGAGTTGAACCCCTCCCAG -3'
(R):5'- TCACCAGGTACACGGACAAG -3'

Sequencing Primer
(F):5'- GAACCCCTCCCAGTGCTC -3'
(R):5'- AGAGGGACCATTAGCTTCTGC -3'

Posted On

2017-12-01