Incidental Mutation 'R6966:Pias3'
ID541986
Institutional Source Beutler Lab
Gene Symbol Pias3
Ensembl Gene ENSMUSG00000028101
Gene Nameprotein inhibitor of activated STAT 3
SynonymsPias3L
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.530) question?
Stock #R6966 (G1)
Quality Score224.009
Status Not validated
Chromosome3
Chromosomal Location96696384-96706070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96702195 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 276 (D276G)
Ref Sequence ENSEMBL: ENSMUSP00000102692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029742] [ENSMUST00000064900] [ENSMUST00000107076] [ENSMUST00000107077] [ENSMUST00000162778] [ENSMUST00000162934] [ENSMUST00000171249] [ENSMUST00000176302] [ENSMUST00000200387]
Predicted Effect probably benign
Transcript: ENSMUST00000029742
SMART Domains Protein: ENSMUSP00000029742
Gene: ENSMUSG00000028100

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:NUDIX 92 252 2.2e-9 PFAM
low complexity region 273 288 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064900
AA Change: D311G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069259
Gene: ENSMUSG00000028101
AA Change: D311G

DomainStartEndE-ValueType
SAP 11 45 3.75e-5 SMART
low complexity region 70 109 N/A INTRINSIC
Pfam:PINIT 126 278 1.1e-38 PFAM
Pfam:zf-MIZ 323 372 1.7e-22 PFAM
low complexity region 608 617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107076
AA Change: D302G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102691
Gene: ENSMUSG00000028101
AA Change: D302G

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 100 N/A INTRINSIC
Pfam:PINIT 113 269 1.1e-45 PFAM
Pfam:zf-Nse 305 361 8e-7 PFAM
Pfam:zf-MIZ 314 363 2.2e-21 PFAM
low complexity region 599 608 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107077
AA Change: D276G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102692
Gene: ENSMUSG00000028101
AA Change: D276G

DomainStartEndE-ValueType
SAP 11 45 3.75e-5 SMART
Pfam:PINIT 87 243 5.3e-46 PFAM
Pfam:zf-Nse 279 335 2.4e-7 PFAM
Pfam:zf-MIZ 288 337 7.4e-22 PFAM
low complexity region 573 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162156
Predicted Effect probably benign
Transcript: ENSMUST00000162778
SMART Domains Protein: ENSMUSP00000125377
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 84 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162934
AA Change: D302G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125747
Gene: ENSMUSG00000028101
AA Change: D302G

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 100 N/A INTRINSIC
Pfam:PINIT 113 269 1.3e-46 PFAM
Pfam:zf-Nse 305 361 7e-8 PFAM
Pfam:zf-MIZ 314 363 2.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171249
SMART Domains Protein: ENSMUSP00000129851
Gene: ENSMUSG00000028100

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:NUDIX 92 235 1.2e-18 PFAM
low complexity region 256 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176302
SMART Domains Protein: ENSMUSP00000134835
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 2 36 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200387
SMART Domains Protein: ENSMUSP00000142879
Gene: ENSMUSG00000028100

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:NUDIX 79 125 4.2e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)] family of transcriptional modulators. The protein functions as a SUMO (small ubiquitin-like modifier)-E3 ligase which catalyzes the covalent attachment of a SUMO protein to specific target substrates. It directly binds to several transcription factors and either blocks or enhances their activity. Alternatively spliced transcript variants of this gene have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Double KO mice display a retinal phenotype reduced M-cone response at P21 and reduced S-cone and rod responses from 7 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,521,435 R177C possibly damaging Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Bahcc1 G A 11: 120,283,159 V1582M probably damaging Het
Baiap2 A T 11: 120,006,405 R529* probably null Het
Bcl9l C T 9: 44,509,388 Q1327* probably null Het
Brsk2 T A 7: 141,984,533 C139S possibly damaging Het
Catsper3 T A 13: 55,798,859 I123N probably damaging Het
Cd84 A G 1: 171,886,409 N325D possibly damaging Het
Chid1 T A 7: 141,496,384 Y357F possibly damaging Het
Clstn2 A T 9: 97,526,406 Y416* probably null Het
Cnot1 A T 8: 95,724,532 L2189Q probably damaging Het
Csnk2b T A 17: 35,117,782 I170L probably benign Het
Dnah3 T C 7: 120,032,754 Q1326R probably damaging Het
Drd1 T C 13: 54,053,545 I210V probably damaging Het
Eef1d G T 15: 75,903,709 Q34K probably benign Het
Fam184a T C 10: 53,654,999 T760A probably benign Het
Fnip1 G T 11: 54,482,559 V199F probably benign Het
Glyatl3 T C 17: 40,904,938 K226E probably damaging Het
Gm19410 C T 8: 35,817,973 T2093I possibly damaging Het
Herc1 A T 9: 66,411,065 E1206D probably benign Het
Hs6st1 G A 1: 36,104,218 W411* probably null Het
Hsf2 C A 10: 57,495,984 S60R probably damaging Het
Hyal5 C A 6: 24,891,292 N368K probably damaging Het
Itgb2l A T 16: 96,430,643 F308I probably benign Het
Kdm7a G A 6: 39,152,839 L468F probably damaging Het
Lamp3 A T 16: 19,699,653 L278* probably null Het
Ly6c1 A T 15: 75,045,440 probably benign Het
Mark3 A G 12: 111,640,024 N524D probably damaging Het
Met T G 6: 17,531,532 L603R possibly damaging Het
Mical1 A T 10: 41,479,754 Q198L probably damaging Het
Nacad T A 11: 6,602,634 I186F possibly damaging Het
Nt5c3b A T 11: 100,429,924 M257K probably benign Het
Nuak2 T C 1: 132,325,032 M108T possibly damaging Het
Nub1 T A 5: 24,689,472 Y51N probably damaging Het
Nxpe5 T C 5: 138,239,417 S68P probably damaging Het
Olfr1124 C T 2: 87,435,279 T264I probably damaging Het
Olfr1174-ps A G 2: 88,311,491 S102P probably benign Het
Olfr798 A G 10: 129,625,764 V99A probably benign Het
Setd7 A G 3: 51,530,184 Y217H probably damaging Het
Slc23a1 A T 18: 35,625,061 I142N probably damaging Het
Slx4ip T C 2: 137,068,224 S310P probably damaging Het
Tcp11l2 G A 10: 84,591,269 R199Q possibly damaging Het
Tgm4 T A 9: 123,051,142 D226E possibly damaging Het
Tspyl4 C A 10: 34,297,677 A55E probably benign Het
Uap1l1 A G 2: 25,364,938 I146T probably damaging Het
Ush2a G A 1: 188,576,244 G2030D probably damaging Het
Uts2r G A 11: 121,161,387 G359D possibly damaging Het
Vwa7 T C 17: 35,017,096 S9P probably benign Het
Zbtb16 A G 9: 48,657,354 C604R probably damaging Het
Zfp804b A G 5: 6,771,615 S483P probably damaging Het
Zfpm1 G A 8: 122,332,165 A175T probably damaging Het
Other mutations in Pias3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Pias3 APN 3 96699422 splice site probably benign
IGL01370:Pias3 APN 3 96703575 missense probably damaging 0.96
IGL01806:Pias3 APN 3 96703757 missense probably benign 0.02
IGL02533:Pias3 APN 3 96699616 missense possibly damaging 0.71
IGL02998:Pias3 APN 3 96702179 missense probably damaging 0.98
IGL03304:Pias3 APN 3 96700031 missense possibly damaging 0.65
R0764:Pias3 UTSW 3 96701295 missense probably damaging 1.00
R1611:Pias3 UTSW 3 96699697 unclassified probably null
R1697:Pias3 UTSW 3 96702225 missense probably damaging 1.00
R1751:Pias3 UTSW 3 96701403 missense probably damaging 1.00
R1767:Pias3 UTSW 3 96701403 missense probably damaging 1.00
R2184:Pias3 UTSW 3 96702221 missense possibly damaging 0.92
R2257:Pias3 UTSW 3 96699646 missense probably benign 0.22
R2398:Pias3 UTSW 3 96703813 missense probably benign 0.00
R2851:Pias3 UTSW 3 96703537 missense possibly damaging 0.94
R3845:Pias3 UTSW 3 96702210 missense probably benign 0.28
R4127:Pias3 UTSW 3 96699666 missense probably damaging 0.97
R4500:Pias3 UTSW 3 96701418 missense probably damaging 1.00
R4628:Pias3 UTSW 3 96699820 missense probably damaging 1.00
R5068:Pias3 UTSW 3 96703855 missense probably damaging 0.98
R5108:Pias3 UTSW 3 96704937 missense possibly damaging 0.88
R5477:Pias3 UTSW 3 96705003 missense probably damaging 0.99
R5498:Pias3 UTSW 3 96702188 missense possibly damaging 0.89
R6457:Pias3 UTSW 3 96699523 missense possibly damaging 0.81
R7235:Pias3 UTSW 3 96704363 missense probably benign
R7538:Pias3 UTSW 3 96702218 missense possibly damaging 0.91
R7552:Pias3 UTSW 3 96701385 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAAGCATCTTCAGGGACGC -3'
(R):5'- GCAGCATCGAAACTCTGCAG -3'

Sequencing Primer
(F):5'- AGGGACGCAGACATCTCTTCTC -3'
(R):5'- CATCGAAACTCTGCAGATGGGC -3'
Posted On2018-11-28