Incidental Mutation 'R6224:Lrfn2'
ID504226
Institutional Source Beutler Lab
Gene Symbol Lrfn2
Ensembl Gene ENSMUSG00000040490
Gene Nameleucine rich repeat and fibronectin type III domain containing 2
Synonyms5730420O05Rik, SALM1
MMRRC Submission 044355-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6224 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location48932379-49097588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49096351 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 501 (T501A)
Ref Sequence ENSEMBL: ENSMUSP00000047573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046254]
Predicted Effect probably damaging
Transcript: ENSMUST00000046254
AA Change: T501A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047573
Gene: ENSMUSG00000040490
AA Change: T501A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
LRRNT 20 56 2.9e0 SMART
LRR 75 98 7.36e0 SMART
LRR_TYP 99 122 1.1e-2 SMART
LRR_TYP 123 146 2.2e-2 SMART
LRR 148 171 4.45e1 SMART
LRR_TYP 172 195 1.56e-2 SMART
LRR 196 220 1.06e1 SMART
LRRCT 242 287 5.53e-4 SMART
IGc2 301 366 8e-12 SMART
low complexity region 401 415 N/A INTRINSIC
FN3 420 500 1.52e-1 SMART
transmembrane domain 533 555 N/A INTRINSIC
low complexity region 613 654 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200509
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit small spleens, small or no thymi, impaired T cell development, and decreased T cell proliferation in response to mitogen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A C 11: 99,838,014 M1R probably null Het
4930505A04Rik A C 11: 30,454,815 N29K probably benign Het
Adamtsl4 T C 3: 95,681,729 Y464C probably damaging Het
Asgr2 T C 11: 70,098,246 V172A probably damaging Het
Atad1 T C 19: 32,698,628 Y132C probably damaging Het
Bpifa6 G A 2: 153,987,153 R200H probably damaging Het
Brd1 A T 15: 88,688,355 M1171K possibly damaging Het
Cadm2 A T 16: 66,664,395 L392Q probably damaging Het
Ccdc183 C T 2: 25,610,582 E333K possibly damaging Het
Cenpe T C 3: 135,243,775 I1335T possibly damaging Het
Cpxm2 T C 7: 132,143,731 N122D probably benign Het
Crls1 T A 2: 132,849,850 probably null Het
Cyp46a1 T C 12: 108,361,560 F460S probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcps T A 9: 35,136,481 T128S probably benign Het
Dcun1d3 A T 7: 119,859,491 L107* probably null Het
Eml1 T C 12: 108,514,508 F397S probably damaging Het
Fanca T A 8: 123,305,281 H348L possibly damaging Het
Foxo1 T A 3: 52,345,672 S419T probably benign Het
Gli3 T C 13: 15,725,145 V1039A probably benign Het
Gm5741 A T 8: 85,067,591 *73R probably null Het
Gp6 A T 7: 4,394,212 F75I probably benign Het
Gpha2 T A 19: 6,227,112 I81N possibly damaging Het
Gspt1 C A 16: 11,224,542 V493L probably benign Het
Igsf10 C A 3: 59,325,510 C1934F probably damaging Het
Irgm1 T C 11: 48,866,886 T49A probably benign Het
Klc4 A G 17: 46,640,062 I207T possibly damaging Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Lama1 T C 17: 67,802,987 V2201A possibly damaging Het
Lilrb4a T A 10: 51,491,649 Y96N probably damaging Het
Lrriq1 A G 10: 103,215,757 I378T probably damaging Het
Mphosph8 T C 14: 56,668,353 M1T probably null Het
Nsd1 T C 13: 55,313,132 S2391P possibly damaging Het
Ogdhl G A 14: 32,342,061 G647D probably benign Het
Olfr480 T C 7: 108,066,742 I19V probably benign Het
Olfr813 A G 10: 129,857,192 K225E probably benign Het
Pbrm1 T A 14: 31,050,111 H387Q probably benign Het
Pdgfrb C A 18: 61,081,939 Y1013* probably null Het
Pitrm1 T C 13: 6,565,054 V562A probably damaging Het
Pnpla8 T C 12: 44,283,028 V121A possibly damaging Het
Psd4 T C 2: 24,401,557 L639P probably damaging Het
Psmc3 G T 2: 91,054,630 R47L probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sesn2 A G 4: 132,502,570 V50A probably benign Het
Slc6a16 G A 7: 45,261,148 G377S probably damaging Het
Slitrk1 A G 14: 108,912,022 F419S probably damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Spata31d1a T A 13: 59,706,320 probably benign Homo
Tgoln1 A T 6: 72,616,001 D165E possibly damaging Het
Tmprss15 T A 16: 79,024,378 T492S probably benign Het
Ttc37 C T 13: 76,118,291 T219M probably benign Het
Zc3h13 T A 14: 75,337,409 M1565K probably damaging Het
Zcwpw1 T C 5: 137,812,036 V358A possibly damaging Het
Zfp607a A G 7: 27,878,582 H359R probably damaging Het
Zzef1 T A 11: 72,855,383 V837E probably damaging Het
Other mutations in Lrfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Lrfn2 APN 17 49070397 missense possibly damaging 0.81
IGL01989:Lrfn2 APN 17 49071085 missense probably damaging 1.00
IGL03324:Lrfn2 APN 17 49070887 missense probably damaging 1.00
IGL02991:Lrfn2 UTSW 17 49070704 missense probably damaging 1.00
R0306:Lrfn2 UTSW 17 49096255 missense probably damaging 0.99
R0539:Lrfn2 UTSW 17 49071044 missense probably damaging 1.00
R1245:Lrfn2 UTSW 17 49096249 critical splice acceptor site probably null
R1414:Lrfn2 UTSW 17 49070829 missense probably benign 0.01
R1437:Lrfn2 UTSW 17 49071225 missense probably damaging 0.97
R1670:Lrfn2 UTSW 17 49096577 missense probably benign 0.01
R2358:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R3711:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R3712:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R4521:Lrfn2 UTSW 17 49069894 start codon destroyed probably null 0.02
R4532:Lrfn2 UTSW 17 49070536 missense probably damaging 1.00
R4724:Lrfn2 UTSW 17 49070434 missense probably damaging 1.00
R5062:Lrfn2 UTSW 17 49070500 missense probably damaging 1.00
R5066:Lrfn2 UTSW 17 49096420 missense probably damaging 1.00
R5348:Lrfn2 UTSW 17 49096690 missense probably benign
R5673:Lrfn2 UTSW 17 49096597 missense probably benign 0.02
R5900:Lrfn2 UTSW 17 49070263 missense possibly damaging 0.82
R6014:Lrfn2 UTSW 17 49069906 missense possibly damaging 0.96
R6087:Lrfn2 UTSW 17 49071126 missense probably benign
R6229:Lrfn2 UTSW 17 49097132 missense possibly damaging 0.88
R6342:Lrfn2 UTSW 17 49097000 missense probably benign 0.27
R6408:Lrfn2 UTSW 17 49070626 missense probably damaging 1.00
R7026:Lrfn2 UTSW 17 49096977 missense probably benign 0.00
R7505:Lrfn2 UTSW 17 49096451 missense probably benign 0.14
R7852:Lrfn2 UTSW 17 49069944 missense possibly damaging 0.69
R7935:Lrfn2 UTSW 17 49069944 missense possibly damaging 0.69
Z1177:Lrfn2 UTSW 17 49070012 frame shift probably null
Z1177:Lrfn2 UTSW 17 49070095 missense not run
Z1177:Lrfn2 UTSW 17 49096715 missense not run
Predicted Primers PCR Primer
(F):5'- CTATTACTCTATATCTGCCTGGGG -3'
(R):5'- GTACACATTGCTGACAGTGGC -3'

Sequencing Primer
(F):5'- ATATCTGCCTGGGGTTTCTCC -3'
(R):5'- GTTGCAGACCTTGTACCGCAC -3'
Posted On2018-02-28