Incidental Mutation 'R6266:Tefm'
ID507022
Institutional Source Beutler Lab
Gene Symbol Tefm
Ensembl Gene ENSMUSG00000046909
Gene Nametranscription elongation factor, mitochondrial
SynonymsFLJ22729, 1110002N22Rik
MMRRC Submission 044378-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R6266 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location80136678-80142175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80137988 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 194 (L194P)
Ref Sequence ENSEMBL: ENSMUSP00000059304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000050207] [ENSMUST00000108239] [ENSMUST00000131601]
Predicted Effect probably benign
Transcript: ENSMUST00000017694
SMART Domains Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1111 1347 5.14e-5 SMART
Blast:AAA 1409 1526 1e-31 BLAST
low complexity region 1573 1583 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050207
AA Change: L194P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059304
Gene: ENSMUSG00000046909
AA Change: L194P

DomainStartEndE-ValueType
Pfam:HHH_3 78 136 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108239
SMART Domains Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1108 1344 5.14e-5 SMART
Blast:AAA 1406 1523 1e-31 BLAST
low complexity region 1570 1580 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000131601
AA Change: L208P
SMART Domains Protein: ENSMUSP00000114770
Gene: ENSMUSG00000046909
AA Change: L208P

DomainStartEndE-ValueType
Pfam:HHH_3 88 147 1.3e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000136996
AA Change: W46R
SMART Domains Protein: ENSMUSP00000122596
Gene: ENSMUSG00000046909
AA Change: W46R

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151815
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,742,312 V147I probably benign Het
2310035C23Rik T G 1: 105,731,282 probably null Het
Akr1c12 T C 13: 4,270,207 T295A probably benign Het
Aldh2 C A 5: 121,568,934 V217L probably damaging Het
Arap3 G A 18: 37,990,791 R392C probably damaging Het
Aurkaip1 T G 4: 155,832,520 L75R probably damaging Het
Blm C A 7: 80,499,940 K640N probably benign Het
Brap A T 5: 121,685,265 T487S probably benign Het
Ccser2 G A 14: 36,879,675 P276L probably damaging Het
Cdc42bpg A G 19: 6,311,473 E343G probably damaging Het
Cecr2 A G 6: 120,761,686 S1097G probably benign Het
D7Ertd443e A T 7: 134,349,785 V53D probably damaging Het
Ddx3y G A Y: 1,266,635 T274I probably damaging Homo
Dnah5 T A 15: 28,335,627 F2246L possibly damaging Het
Dock3 T A 9: 106,964,753 H959L probably damaging Het
Dpy19l1 A G 9: 24,439,146 S406P probably damaging Het
Efcab8 T C 2: 153,783,768 L116P probably damaging Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fbxl12 A T 9: 20,638,615 L271Q probably damaging Het
Fmn1 T A 2: 113,596,338 N1133K probably damaging Het
Frmpd2 T C 14: 33,565,907 S1219P probably benign Het
Gm7298 A T 6: 121,782,704 R1187S probably damaging Het
H6pd T C 4: 149,995,957 I136V probably benign Het
Hyal2 A G 9: 107,570,715 N189S probably benign Het
Jmjd1c C T 10: 67,249,660 P2410S probably damaging Het
Larp1 A G 11: 58,042,263 D231G probably damaging Het
Lilra5 T A 7: 4,241,928 S233T possibly damaging Het
Lrrc43 T C 5: 123,503,277 F508S probably damaging Het
Marc2 T C 1: 184,833,943 R85G probably damaging Het
March4 T C 1: 72,452,488 Y208C probably damaging Het
Nr1h2 A T 7: 44,552,052 C45* probably null Het
Olfr1123 T A 2: 87,419,006 S319R probably benign Het
Olfr138 A G 17: 38,275,148 I126V probably benign Het
Ppp2r5d G T 17: 46,685,703 probably null Het
Prpf40a A T 2: 53,156,627 S324T probably benign Het
Psmb7 T C 2: 38,640,187 D94G probably damaging Het
Psmd11 A G 11: 80,445,941 T140A probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rbp3 G A 14: 33,954,461 R122H probably benign Het
Rrp8 T C 7: 105,736,389 E3G probably damaging Het
Sacm1l T C 9: 123,542,420 S37P probably damaging Het
Slc12a3 A G 8: 94,358,471 R939G possibly damaging Het
Slc20a1 T C 2: 129,209,894 S608P possibly damaging Het
Sntg1 T C 1: 8,554,729 Q281R possibly damaging Het
Terf2ip T A 8: 112,011,915 V145E probably damaging Het
Tmem231 T A 8: 111,915,265 E219V probably null Het
Tmx3 T A 18: 90,537,210 probably null Het
Tns3 G A 11: 8,492,987 P459S probably damaging Het
Trav13d-1 T A 14: 52,851,763 S76R probably benign Het
Trp63 A G 16: 25,862,460 N254S probably damaging Het
Tsen34 A G 7: 3,693,985 probably benign Het
Unc13d A G 11: 116,068,238 V701A probably damaging Het
Usp36 A G 11: 118,268,585 S513P probably damaging Het
Uspl1 T A 5: 149,204,366 S392T probably damaging Het
Vmn2r102 T A 17: 19,678,745 C450S probably benign Het
Zfp128 T C 7: 12,890,970 Y422H possibly damaging Het
Zkscan7 C T 9: 122,895,234 Q423* probably null Het
Other mutations in Tefm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Tefm APN 11 80137997 nonsense probably null
IGL02164:Tefm APN 11 80140089 missense probably damaging 1.00
IGL02686:Tefm APN 11 80136896 missense probably damaging 1.00
R2037:Tefm UTSW 11 80140230 missense probably damaging 0.96
R4255:Tefm UTSW 11 80140249 missense probably damaging 1.00
R4367:Tefm UTSW 11 80140330 missense probably benign 0.06
R4461:Tefm UTSW 11 80138049 splice site probably null
R4727:Tefm UTSW 11 80140453 unclassified probably benign
R4839:Tefm UTSW 11 80137121 missense probably benign 0.19
R4888:Tefm UTSW 11 80140359 missense possibly damaging 0.59
R5894:Tefm UTSW 11 80140231 missense probably damaging 0.96
R6547:Tefm UTSW 11 80140384 splice site probably null
R8222:Tefm UTSW 11 80140404 missense
Predicted Primers PCR Primer
(F):5'- AGCTATAATAGTAAAAGGTGCCCC -3'
(R):5'- GAGTGACCCTTAAGACATCTATTCG -3'

Sequencing Primer
(F):5'- TAGTAAAAGGTGCCCCAAAGAC -3'
(R):5'- GCTGTGAGATTTCTACACTT -3'
Posted On2018-03-15