Incidental Mutation 'R6547:Tefm'
ID 521309
Institutional Source Beutler Lab
Gene Symbol Tefm
Ensembl Gene ENSMUSG00000046909
Gene Name transcription elongation factor, mitochondrial
Synonyms FLJ22729, 1110002N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R6547 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 80136678-80142175 bp(-) (GRCm38)
Type of Mutation splice site (4590 bp from exon)
DNA Base Change (assembly) T to G at 80140384 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000050207] [ENSMUST00000108239] [ENSMUST00000131601]
AlphaFold Q5SSK3
Predicted Effect probably null
Transcript: ENSMUST00000017694
SMART Domains Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1111 1347 5.14e-5 SMART
Blast:AAA 1409 1526 1e-31 BLAST
low complexity region 1573 1583 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050207
SMART Domains Protein: ENSMUSP00000059304
Gene: ENSMUSG00000046909

DomainStartEndE-ValueType
Pfam:HHH_3 78 136 1.7e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108239
SMART Domains Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1108 1344 5.14e-5 SMART
Blast:AAA 1406 1523 1e-31 BLAST
low complexity region 1570 1580 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131601
AA Change: T9P

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114770
Gene: ENSMUSG00000046909
AA Change: T9P

DomainStartEndE-ValueType
Pfam:HHH_3 88 147 1.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136996
SMART Domains Protein: ENSMUSP00000122596
Gene: ENSMUSG00000046909

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151815
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,659,907 probably benign Het
9230113P08Rik T A 9: 35,908,485 M15K probably null Het
Abca13 T A 11: 9,274,757 V490E probably benign Het
Abca2 G T 2: 25,433,338 G106V possibly damaging Het
Ablim3 T C 18: 61,823,929 T276A probably benign Het
Anxa7 A G 14: 20,469,393 V119A probably benign Het
Arl9 A G 5: 77,010,410 probably null Het
Atm T C 9: 53,440,157 Y2964C probably damaging Het
Bbs9 T C 9: 22,514,069 Y140H probably benign Het
Calcr A T 6: 3,717,177 D94E probably damaging Het
Celsr3 T A 9: 108,829,128 Y937N probably damaging Het
Clca3a1 C T 3: 144,736,947 A779T probably damaging Het
Clec9a T A 6: 129,416,376 V94D probably benign Het
Colec12 G T 18: 9,840,351 L57F probably damaging Het
Fa2h T C 8: 111,348,020 Y317C probably damaging Het
Fam126a T C 5: 23,965,100 N417S probably benign Het
Flnc A G 6: 29,448,608 T1282A probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Hcn2 G T 10: 79,717,152 V162L probably benign Het
Kbtbd11 T A 8: 15,027,641 V80E possibly damaging Het
Lama4 A G 10: 39,073,656 D915G probably damaging Het
Limch1 A T 5: 67,028,774 E806V probably damaging Het
Mppe1 T C 18: 67,228,988 I169V probably benign Het
Msc A C 1: 14,755,745 S2A possibly damaging Het
Nploc4 A G 11: 120,428,522 probably null Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nrap G T 19: 56,351,566 H840N probably benign Het
Olfr151 T A 9: 37,730,495 M163L probably benign Het
Pdlim1 G A 19: 40,223,120 T243I probably damaging Het
Pfkl T A 10: 77,995,354 M318L probably benign Het
Rap1gds1 C A 3: 138,955,338 R426L probably damaging Het
Ric1 A G 19: 29,594,826 N674D probably damaging Het
Rp1 G A 1: 4,170,305 T875I unknown Het
Rtn1 G T 12: 72,308,761 S137Y possibly damaging Het
Scn2a A G 2: 65,715,897 I935V probably benign Het
Serpina1a C T 12: 103,855,921 V251M probably damaging Het
Slc19a3 A G 1: 83,022,900 V132A probably damaging Het
Slc26a6 T A 9: 108,860,782 probably null Het
Slc2a5 T A 4: 150,135,619 V164D possibly damaging Het
Slc4a1 T A 11: 102,356,735 T441S probably damaging Het
Stk33 T C 7: 109,320,835 I366V possibly damaging Het
Syt14 G T 1: 192,901,869 H696N possibly damaging Het
Tcaim T A 9: 122,814,466 V77D probably benign Het
Tekt3 T A 11: 63,070,478 S158T possibly damaging Het
Tmem2 A T 19: 21,844,831 T1197S probably benign Het
Tspan11 T A 6: 127,949,803 M238K possibly damaging Het
Unc5c A T 3: 141,790,019 T476S probably benign Het
Usp9y A T Y: 1,444,612 L109Q probably damaging Homo
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps13c C A 9: 67,973,365 Q3495K probably damaging Het
Zbtb10 G A 3: 9,251,703 A192T probably benign Het
Zfp316 A T 5: 143,254,197 V689D probably damaging Het
Zswim1 A G 2: 164,824,796 probably benign Het
Zswim5 T C 4: 116,986,903 L1046P probably damaging Het
Other mutations in Tefm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Tefm APN 11 80137997 nonsense probably null
IGL02164:Tefm APN 11 80140089 missense probably damaging 1.00
IGL02686:Tefm APN 11 80136896 missense probably damaging 1.00
R2037:Tefm UTSW 11 80140230 missense probably damaging 0.96
R4255:Tefm UTSW 11 80140249 missense probably damaging 1.00
R4367:Tefm UTSW 11 80140330 missense probably benign 0.06
R4461:Tefm UTSW 11 80138049 splice site probably null
R4727:Tefm UTSW 11 80140453 unclassified probably benign
R4839:Tefm UTSW 11 80137121 missense probably benign 0.19
R4888:Tefm UTSW 11 80140359 missense possibly damaging 0.59
R5894:Tefm UTSW 11 80140231 missense probably damaging 0.96
R6266:Tefm UTSW 11 80137988 missense probably damaging 1.00
R8222:Tefm UTSW 11 80140404 missense
Predicted Primers PCR Primer
(F):5'- ACACTGGCAACACGTTTCTC -3'
(R):5'- CTCTGTGTAGTACTGGCTATCCTG -3'

Sequencing Primer
(F):5'- AACACGTTTCTCAGGTGCAG -3'
(R):5'- TATGAAGTCAAGGCCATCCTGGTC -3'
Posted On 2018-06-06