Incidental Mutation 'R6547:Tefm'
ID521309
Institutional Source Beutler Lab
Gene Symbol Tefm
Ensembl Gene ENSMUSG00000046909
Gene Nametranscription elongation factor, mitochondrial
SynonymsFLJ22729, 1110002N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R6547 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location80136678-80142175 bp(-) (GRCm38)
Type of Mutationunclassified (4590 bp from exon)
DNA Base Change (assembly) T to G at 80140384 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000050207] [ENSMUST00000108239] [ENSMUST00000131601]
Predicted Effect probably null
Transcript: ENSMUST00000017694
SMART Domains Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1111 1347 5.14e-5 SMART
Blast:AAA 1409 1526 1e-31 BLAST
low complexity region 1573 1583 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050207
SMART Domains Protein: ENSMUSP00000059304
Gene: ENSMUSG00000046909

DomainStartEndE-ValueType
Pfam:HHH_3 78 136 1.7e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108239
SMART Domains Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1108 1344 5.14e-5 SMART
Blast:AAA 1406 1523 1e-31 BLAST
low complexity region 1570 1580 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131601
AA Change: T9P

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114770
Gene: ENSMUSG00000046909
AA Change: T9P

DomainStartEndE-ValueType
Pfam:HHH_3 88 147 1.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136996
SMART Domains Protein: ENSMUSP00000122596
Gene: ENSMUSG00000046909

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151815
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,659,907 probably benign Het
9230113P08Rik T A 9: 35,908,485 M15K probably null Het
Abca13 T A 11: 9,274,757 V490E probably benign Het
Abca2 G T 2: 25,433,338 G106V possibly damaging Het
Ablim3 T C 18: 61,823,929 T276A probably benign Het
Anxa7 A G 14: 20,469,393 V119A probably benign Het
Arl9 A G 5: 77,010,410 probably null Het
Atm T C 9: 53,440,157 Y2964C probably damaging Het
Bbs9 T C 9: 22,514,069 Y140H probably benign Het
Calcr A T 6: 3,717,177 D94E probably damaging Het
Celsr3 T A 9: 108,829,128 Y937N probably damaging Het
Clca3a1 C T 3: 144,736,947 A779T probably damaging Het
Clec9a T A 6: 129,416,376 V94D probably benign Het
Colec12 G T 18: 9,840,351 L57F probably damaging Het
Fa2h T C 8: 111,348,020 Y317C probably damaging Het
Fam126a T C 5: 23,965,100 N417S probably benign Het
Flnc A G 6: 29,448,608 T1282A probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Hcn2 G T 10: 79,717,152 V162L probably benign Het
Kbtbd11 T A 8: 15,027,641 V80E possibly damaging Het
Lama4 A G 10: 39,073,656 D915G probably damaging Het
Limch1 A T 5: 67,028,774 E806V probably damaging Het
Mppe1 T C 18: 67,228,988 I169V probably benign Het
Msc A C 1: 14,755,745 S2A possibly damaging Het
Nploc4 A G 11: 120,428,522 probably null Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nrap G T 19: 56,351,566 H840N probably benign Het
Olfr151 T A 9: 37,730,495 M163L probably benign Het
Pdlim1 G A 19: 40,223,120 T243I probably damaging Het
Pfkl T A 10: 77,995,354 M318L probably benign Het
Rap1gds1 C A 3: 138,955,338 R426L probably damaging Het
Ric1 A G 19: 29,594,826 N674D probably damaging Het
Rp1 G A 1: 4,170,305 T875I unknown Het
Rtn1 G T 12: 72,308,761 S137Y possibly damaging Het
Scn2a A G 2: 65,715,897 I935V probably benign Het
Serpina1a C T 12: 103,855,921 V251M probably damaging Het
Slc19a3 A G 1: 83,022,900 V132A probably damaging Het
Slc26a6 T A 9: 108,860,782 probably null Het
Slc2a5 T A 4: 150,135,619 V164D possibly damaging Het
Slc4a1 T A 11: 102,356,735 T441S probably damaging Het
Stk33 T C 7: 109,320,835 I366V possibly damaging Het
Syt14 G T 1: 192,901,869 H696N possibly damaging Het
Tcaim T A 9: 122,814,466 V77D probably benign Het
Tekt3 T A 11: 63,070,478 S158T possibly damaging Het
Tmem2 A T 19: 21,844,831 T1197S probably benign Het
Tspan11 T A 6: 127,949,803 M238K possibly damaging Het
Unc5c A T 3: 141,790,019 T476S probably benign Het
Usp9y A T Y: 1,444,612 L109Q probably damaging Homo
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps13c C A 9: 67,973,365 Q3495K probably damaging Het
Zbtb10 G A 3: 9,251,703 A192T probably benign Het
Zfp316 A T 5: 143,254,197 V689D probably damaging Het
Zswim1 A G 2: 164,824,796 probably benign Het
Zswim5 T C 4: 116,986,903 L1046P probably damaging Het
Other mutations in Tefm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Tefm APN 11 80137997 nonsense probably null
IGL02164:Tefm APN 11 80140089 missense probably damaging 1.00
IGL02686:Tefm APN 11 80136896 missense probably damaging 1.00
R2037:Tefm UTSW 11 80140230 missense probably damaging 0.96
R4255:Tefm UTSW 11 80140249 missense probably damaging 1.00
R4367:Tefm UTSW 11 80140330 missense probably benign 0.06
R4461:Tefm UTSW 11 80138049 unclassified probably null
R4727:Tefm UTSW 11 80140453 unclassified probably benign
R4839:Tefm UTSW 11 80137121 missense probably benign 0.19
R4888:Tefm UTSW 11 80140359 missense possibly damaging 0.59
R5894:Tefm UTSW 11 80140231 missense probably damaging 0.96
R6266:Tefm UTSW 11 80137988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGGCAACACGTTTCTC -3'
(R):5'- CTCTGTGTAGTACTGGCTATCCTG -3'

Sequencing Primer
(F):5'- AACACGTTTCTCAGGTGCAG -3'
(R):5'- TATGAAGTCAAGGCCATCCTGGTC -3'
Posted On2018-06-06