Incidental Mutation 'R6286:BC080695'
ID508226
Institutional Source Beutler Lab
Gene Symbol BC080695
Ensembl Gene ENSMUSG00000070618
Gene NamecDNA sequence BC080695
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6286 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location143551700-143573798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143571226 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 72 (V72D)
Ref Sequence ENSEMBL: ENSMUSP00000101400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105765] [ENSMUST00000105774]
Predicted Effect probably benign
Transcript: ENSMUST00000105765
AA Change: V72D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101391
Gene: ENSMUSG00000070618
AA Change: V72D

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 5e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105774
AA Change: V72D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101400
Gene: ENSMUSG00000070618
AA Change: V72D

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 5e-12 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T A 17: 71,880,847 M1300L probably damaging Het
C3 A T 17: 57,224,118 I356N probably damaging Het
Cntnap5b T A 1: 100,255,073 S276T possibly damaging Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp11a1 G A 9: 58,017,418 probably benign Het
Ddx4 T C 13: 112,613,735 T421A probably damaging Het
Dnttip2 A G 3: 122,284,400 T694A probably damaging Het
Eif3b G T 5: 140,419,811 D151Y probably damaging Het
Fhad1 T A 4: 141,920,898 E219V probably damaging Het
Gdf2 C T 14: 33,945,100 R260C probably damaging Het
Gm14295 T C 2: 176,809,568 Y284H possibly damaging Het
Gm45861 A G 8: 27,529,591 T745A unknown Het
Grin2a G A 16: 9,761,775 T208I possibly damaging Het
Ide T A 19: 37,278,010 Y798F unknown Het
Llgl1 G A 11: 60,709,532 G569D probably damaging Het
Mrpl9 G C 3: 94,443,790 E92D probably benign Het
Muc16 T A 9: 18,644,389 H3536L unknown Het
Nasp T C 4: 116,604,788 Y526C probably damaging Het
Nfx1 A G 4: 40,986,728 N404D probably damaging Het
Nsrp1 A G 11: 77,049,443 I112T probably damaging Het
Olfr145 A T 9: 37,897,778 I125F probably damaging Het
Olfr789 T C 10: 129,487,628 L206P probably damaging Het
Oxsr1 A G 9: 119,264,882 V235A probably damaging Het
Pamr1 C T 2: 102,640,948 Q539* probably null Het
Ptpn4 A G 1: 119,721,862 probably null Het
Ranbp2 C T 10: 58,479,572 A2038V probably benign Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Homo
Sept5 A G 16: 18,623,377 V253A probably damaging Het
Slc22a13 C A 9: 119,208,712 E117* probably null Het
Slc9c1 T C 16: 45,577,831 I653T probably benign Het
Slco6c1 T A 1: 97,125,720 H152L possibly damaging Het
Sp2 A C 11: 96,961,546 V184G probably benign Het
Taok1 T A 11: 77,553,773 H492L probably benign Het
Tas2r110 G A 6: 132,868,527 D174N probably benign Het
Trim24 G A 6: 37,919,491 probably null Het
Ttc37 T C 13: 76,143,240 L993P probably damaging Het
Ttn G A 2: 76,750,977 R21445* probably null Het
Ttn A G 2: 76,775,623 Y16502H probably damaging Het
Vmn2r84 A C 10: 130,390,868 M367R possibly damaging Het
Zfp46 T C 4: 136,291,009 S385P probably damaging Het
Other mutations in BC080695
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:BC080695 APN 4 143571156 missense probably benign 0.42
IGL02533:BC080695 APN 4 143571002 utr 5 prime probably benign
R0352:BC080695 UTSW 4 143571308 splice site probably benign
R1600:BC080695 UTSW 4 143571967 missense possibly damaging 0.78
R3121:BC080695 UTSW 4 143571013 start codon destroyed probably null 1.00
R4005:BC080695 UTSW 4 143572269 missense probably benign 0.00
R4477:BC080695 UTSW 4 143571162 missense probably benign 0.21
R4639:BC080695 UTSW 4 143571897 missense probably benign 0.22
R4791:BC080695 UTSW 4 143570989 start gained probably benign
R5118:BC080695 UTSW 4 143571127 missense probably damaging 1.00
R5353:BC080695 UTSW 4 143571237 missense probably benign 0.00
R5861:BC080695 UTSW 4 143571240 missense probably benign
R6163:BC080695 UTSW 4 143572035 missense probably damaging 1.00
R6958:BC080695 UTSW 4 143571259 missense probably damaging 1.00
R7391:BC080695 UTSW 4 143572306 missense probably damaging 1.00
R7625:BC080695 UTSW 4 143572251 missense probably benign 0.00
R8189:BC080695 UTSW 4 143571960 missense probably benign
R8190:BC080695 UTSW 4 143571960 missense probably benign
R8192:BC080695 UTSW 4 143571960 missense probably benign
R8219:BC080695 UTSW 4 143571960 missense probably benign
R8221:BC080695 UTSW 4 143571960 missense probably benign
R8223:BC080695 UTSW 4 143571960 missense probably benign
R8226:BC080695 UTSW 4 143571960 missense probably benign
Z1176:BC080695 UTSW 4 143572252 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAGCTTGGCAGTACAGAG -3'
(R):5'- ACTGTCCAGGACACTGTAACTC -3'

Sequencing Primer
(F):5'- GCAGTACAGAGCCTGGC -3'
(R):5'- TGTCCAGGACACTGTAACTCTTCAAG -3'
Posted On2018-03-15