Incidental Mutation 'R6336:Olfr38'
ID510755
Institutional Source Beutler Lab
Gene Symbol Olfr38
Ensembl Gene ENSMUSG00000095236
Gene Nameolfactory receptor 38
SynonymsMOR257-2, 18A, GA_x6K02T2P3E9-4797841-4796888
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42756404-42763231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42762657 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 202 (S202P)
Ref Sequence ENSEMBL: ENSMUSP00000149726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074499] [ENSMUST00000215796]
Predicted Effect probably damaging
Transcript: ENSMUST00000074499
AA Change: S202P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093654
Gene: ENSMUSG00000095236
AA Change: S202P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.8e-52 PFAM
Pfam:7tm_1 41 290 5.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215796
AA Change: S202P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Olfr38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Olfr38 APN 6 42762112 missense probably damaging 0.99
IGL01567:Olfr38 APN 6 42762727 missense probably benign 0.07
IGL02097:Olfr38 APN 6 42762460 missense probably damaging 0.98
IGL02186:Olfr38 APN 6 42762946 missense probably null 0.96
IGL02473:Olfr38 APN 6 42762706 missense probably damaging 1.00
R0541:Olfr38 UTSW 6 42762220 missense probably damaging 1.00
R1210:Olfr38 UTSW 6 42762667 missense possibly damaging 0.79
R1368:Olfr38 UTSW 6 42762679 missense possibly damaging 0.91
R2383:Olfr38 UTSW 6 42762459 missense probably benign 0.44
R4614:Olfr38 UTSW 6 42762418 missense probably benign 0.07
R4616:Olfr38 UTSW 6 42762418 missense probably benign 0.07
R4844:Olfr38 UTSW 6 42762460 missense probably damaging 0.98
R5121:Olfr38 UTSW 6 42762997 nonsense probably null
R5951:Olfr38 UTSW 6 42762559 missense probably damaging 1.00
R6061:Olfr38 UTSW 6 42762965 missense probably damaging 0.99
R7414:Olfr38 UTSW 6 42762828 missense probably damaging 1.00
X0018:Olfr38 UTSW 6 42762935 missense probably damaging 0.99
Z1177:Olfr38 UTSW 6 42762207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCACATCATGGGTCAGTGG -3'
(R):5'- AGCATGGGTGTCAAGATAGC -3'

Sequencing Primer
(F):5'- ATCATGGGTCAGTGGCTCCATC -3'
(R):5'- TAGAACAGAGACATCAACTTCTCCTG -3'
Posted On2018-04-02