Incidental Mutation 'R6382:Cnot6l'
ID 515361
Institutional Source Beutler Lab
Gene Symbol Cnot6l
Ensembl Gene ENSMUSG00000034724
Gene Name CCR4-NOT transcription complex, subunit 6-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock # R6382 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 96070333-96164171 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 96128999 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 110 (R110L)
Ref Sequence ENSEMBL: ENSMUSP00000113821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036646] [ENSMUST00000113005] [ENSMUST00000122003] [ENSMUST00000129646] [ENSMUST00000137207] [ENSMUST00000141383] [ENSMUST00000154500] [ENSMUST00000155901]
AlphaFold Q8VEG6
Predicted Effect probably benign
Transcript: ENSMUST00000036646
Predicted Effect probably damaging
Transcript: ENSMUST00000113005
AA Change: R115L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108629
Gene: ENSMUSG00000034724
AA Change: R115L

DomainStartEndE-ValueType
LRR 55 77 4.34e-1 SMART
LRR 78 100 1.01e-1 SMART
LRR 101 124 7.55e-1 SMART
Pfam:Exo_endo_phos 192 529 7.3e-22 PFAM
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122003
AA Change: R110L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113821
Gene: ENSMUSG00000034724
AA Change: R110L

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR 73 95 1.01e-1 SMART
LRR 96 119 7.55e-1 SMART
Pfam:Exo_endo_phos 187 433 1.3e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000129646
AA Change: R110L

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123653
Gene: ENSMUSG00000034724
AA Change: R110L

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR 73 95 1.01e-1 SMART
LRR 96 119 7.55e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137066
Predicted Effect probably benign
Transcript: ENSMUST00000137207
SMART Domains Protein: ENSMUSP00000121627
Gene: ENSMUSG00000034724

DomainStartEndE-ValueType
LRR_TYP 50 73 6.67e-2 SMART
Pfam:LRR_1 75 87 6.9e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141383
SMART Domains Protein: ENSMUSP00000114436
Gene: ENSMUSG00000034724

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR_TYP 73 96 1.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154500
Predicted Effect probably damaging
Transcript: ENSMUST00000155901
AA Change: R110L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119415
Gene: ENSMUSG00000034724
AA Change: R110L

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR 73 95 1.01e-1 SMART
LRR 96 119 7.55e-1 SMART
Pfam:Exo_endo_phos 187 524 2.2e-23 PFAM
low complexity region 527 540 N/A INTRINSIC
Meta Mutation Damage Score 0.2593 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.5%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,600,986 M148K probably benign Het
Aldoc T C 11: 78,325,742 I242T probably benign Het
Camta2 T C 11: 70,672,041 T927A probably damaging Het
Ccdc105 G A 10: 78,752,841 T45I possibly damaging Het
Ccdc30 T C 4: 119,404,166 R25G possibly damaging Het
Cdh16 T A 8: 104,621,543 M181L possibly damaging Het
Clstn1 A T 4: 149,626,120 probably null Het
Col7a1 G A 9: 108,975,393 S2264N unknown Het
Cspp1 A G 1: 10,083,475 probably null Het
Cul1 T A 6: 47,502,439 L213Q probably damaging Het
Cuta T C 17: 26,938,454 Q124R probably benign Het
Cyp1a1 T A 9: 57,700,690 N200K probably damaging Het
Dag1 C A 9: 108,208,137 A602S possibly damaging Het
Gm4707 G A 17: 71,459,243 probably benign Het
Gm813 T C 16: 58,613,910 E148G possibly damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
H2-T23 T C 17: 36,031,832 Y138C probably damaging Het
Hnf4a A T 2: 163,569,006 M408L probably benign Het
Hpse2 A G 19: 43,388,202 L37P possibly damaging Het
Hsd17b6 A T 10: 127,991,327 I292N probably damaging Het
Hsp90aa1 A T 12: 110,695,517 probably null Het
Ifit1bl1 T A 19: 34,594,883 Y58F probably benign Het
Igkv10-95 A G 6: 68,680,688 T43A probably benign Het
Igkv6-17 C T 6: 70,371,830 Q62* probably null Het
Jakmip2 A G 18: 43,571,179 S367P possibly damaging Het
Lrrc40 A G 3: 158,058,696 D416G probably damaging Het
Mdm2 A G 10: 117,692,721 V177A probably benign Het
Mpp1 TGAGACGAACTCTCCGAG TGAG X: 75,125,769 probably null Het
Myo1b C T 1: 51,774,307 probably null Het
Notch2 A G 3: 98,141,543 D1799G probably damaging Het
Obscn C T 11: 58,999,413 G7431D unknown Het
Obscn A T 11: 59,042,208 C4781S probably damaging Het
Olfr1351 C A 10: 79,017,517 S65Y probably damaging Het
Olfr237-ps1 T A 6: 43,153,965 I220N probably damaging Het
Pard3 T A 8: 127,376,783 V411D probably damaging Het
Pfkl T C 10: 77,999,837 R246G probably damaging Het
Pgs1 T C 11: 118,003,360 Y238H probably damaging Het
Pik3c2g A G 6: 139,719,998 E15G possibly damaging Het
Pja2 A G 17: 64,309,615 V95A probably benign Het
Ripor2 T C 13: 24,677,845 I207T possibly damaging Het
Rps15 A G 10: 80,293,986 Y115C probably damaging Het
Shkbp1 C A 7: 27,352,059 E192* probably null Het
Slc23a4 T A 6: 34,957,043 M42L probably benign Het
Snx25 T A 8: 46,055,991 S373C probably benign Het
Sppl2a A T 2: 126,917,029 probably null Het
Tpcn2 A G 7: 145,269,749 S256P possibly damaging Het
Txk C T 5: 72,736,480 probably benign Het
Ubr2 C G 17: 46,957,315 W991S possibly damaging Het
Ufc1 A G 1: 171,294,675 W28R probably damaging Het
Unc93b1 C A 19: 3,935,297 A35E probably benign Het
Ush2a A G 1: 188,814,302 N3425S probably benign Het
Vmn1r32 A G 6: 66,553,361 Y144H probably benign Het
Vmn1r76 A G 7: 11,930,499 F228L probably damaging Het
Zfc3h1 A G 10: 115,407,908 N715D probably benign Het
Zfp933 T C 4: 147,825,868 S424G probably benign Het
Other mutations in Cnot6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Cnot6l APN 5 96086246 missense probably damaging 1.00
IGL02102:Cnot6l APN 5 96091659 missense probably damaging 0.98
BB005:Cnot6l UTSW 5 96131068 missense possibly damaging 0.95
BB015:Cnot6l UTSW 5 96131068 missense possibly damaging 0.95
R0443:Cnot6l UTSW 5 96091745 splice site probably benign
R0448:Cnot6l UTSW 5 96080046 missense probably benign 0.00
R1436:Cnot6l UTSW 5 96134112 missense probably damaging 1.00
R2198:Cnot6l UTSW 5 96079941 missense possibly damaging 0.79
R4240:Cnot6l UTSW 5 96077362 missense probably benign
R4506:Cnot6l UTSW 5 96086174 missense possibly damaging 0.93
R4624:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4627:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4629:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4868:Cnot6l UTSW 5 96083023 missense probably damaging 1.00
R4936:Cnot6l UTSW 5 96079937 missense probably damaging 1.00
R5597:Cnot6l UTSW 5 96131119 missense probably damaging 1.00
R5781:Cnot6l UTSW 5 96086165 missense probably benign 0.31
R6142:Cnot6l UTSW 5 96082978 missense probably benign 0.00
R6166:Cnot6l UTSW 5 96079940 missense possibly damaging 0.79
R6189:Cnot6l UTSW 5 96098277 missense probably benign 0.18
R6515:Cnot6l UTSW 5 96161678 intron probably benign
R6773:Cnot6l UTSW 5 96094299 missense probably damaging 1.00
R7326:Cnot6l UTSW 5 96077299 missense probably benign 0.00
R7466:Cnot6l UTSW 5 96131128 missense probably benign 0.01
R7832:Cnot6l UTSW 5 96094225 missense possibly damaging 0.90
R7928:Cnot6l UTSW 5 96131068 missense possibly damaging 0.95
R8310:Cnot6l UTSW 5 96091676 missense probably benign
R8499:Cnot6l UTSW 5 96077317 missense probably damaging 1.00
R8698:Cnot6l UTSW 5 96077290 missense probably damaging 1.00
R9029:Cnot6l UTSW 5 96098277 missense probably benign 0.18
R9100:Cnot6l UTSW 5 96083016 missense probably damaging 1.00
R9377:Cnot6l UTSW 5 96128967 missense probably benign 0.01
R9485:Cnot6l UTSW 5 96082999 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGCACCTTTAACAAATCCTTC -3'
(R):5'- TGTGCTACAGAATGAGTGAGTC -3'

Sequencing Primer
(F):5'- AACAAATCCTTCTCACTCTTTCAG -3'
(R):5'- GAATGACAAATGCAGACATT -3'
Posted On 2018-05-04