Incidental Mutation 'R8499:Cnot6l'
ID 658410
Institutional Source Beutler Lab
Gene Symbol Cnot6l
Ensembl Gene ENSMUSG00000034724
Gene Name CCR4-NOT transcription complex, subunit 6-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock # R8499 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 96070333-96164171 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 96077317 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 506 (W506R)
Ref Sequence ENSEMBL: ENSMUSP00000119415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036646] [ENSMUST00000113005] [ENSMUST00000122003] [ENSMUST00000155901]
AlphaFold Q8VEG6
Predicted Effect probably benign
Transcript: ENSMUST00000036646
Predicted Effect probably damaging
Transcript: ENSMUST00000113005
AA Change: W511R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108629
Gene: ENSMUSG00000034724
AA Change: W511R

DomainStartEndE-ValueType
LRR 55 77 4.34e-1 SMART
LRR 78 100 1.01e-1 SMART
LRR 101 124 7.55e-1 SMART
Pfam:Exo_endo_phos 192 529 7.3e-22 PFAM
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122003
SMART Domains Protein: ENSMUSP00000113821
Gene: ENSMUSG00000034724

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR 73 95 1.01e-1 SMART
LRR 96 119 7.55e-1 SMART
Pfam:Exo_endo_phos 187 433 1.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155901
AA Change: W506R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119415
Gene: ENSMUSG00000034724
AA Change: W506R

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR 73 95 1.01e-1 SMART
LRR 96 119 7.55e-1 SMART
Pfam:Exo_endo_phos 187 524 2.2e-23 PFAM
low complexity region 527 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,152 D485G probably damaging Het
Ap4b1 G A 3: 103,820,702 R344Q probably damaging Het
Apol7c G T 15: 77,526,080 P222Q possibly damaging Het
Atf6b T C 17: 34,650,822 L272P probably damaging Het
Atp11b G T 3: 35,810,705 R559I probably benign Het
Bhmt T A 13: 93,620,092 I343F probably benign Het
Btbd7 A T 12: 102,788,372 F712I probably damaging Het
Card14 T C 11: 119,331,244 L455P probably benign Het
Cast A T 13: 74,798,716 H26Q probably benign Het
Clcn1 A G 6: 42,307,199 N567S probably damaging Het
Dynap T A 18: 70,240,973 I161L unknown Het
Eif4g3 A C 4: 138,165,928 T996P probably damaging Het
Exoc8 A G 8: 124,897,110 Y173H probably benign Het
Fbll1 C T 11: 35,798,080 V119M probably damaging Het
Fbxw22 A T 9: 109,385,000 F249L probably benign Het
Fxyd1 C A 7: 31,053,104 probably benign Het
Gm10130 T C 2: 150,362,987 S74P probably benign Het
Grhl3 C A 4: 135,549,238 probably null Het
Grk4 A G 5: 34,745,346 E414G possibly damaging Het
H2-Q5 A G 17: 35,394,844 D123G Het
H2-Q5 C T 17: 35,394,969 R165* probably null Het
Hgf A T 5: 16,566,856 E160D probably damaging Het
Hist1h2bg T A 13: 23,571,706 S92T probably benign Het
Ifi211 T C 1: 173,905,520 I192V probably benign Het
Klk1b22 T C 7: 44,112,720 F7L probably benign Het
Lcmt1 C A 7: 123,430,148 T331N probably benign Het
Lrrc36 A T 8: 105,449,536 T181S possibly damaging Het
Ltbp3 T A 19: 5,748,684 S520T probably benign Het
Nacc1 A T 8: 84,676,716 C177S probably damaging Het
Nedd4l T A 18: 65,209,657 V888E probably damaging Het
Oc90 C T 15: 65,881,556 G305S probably damaging Het
Olfr556 T A 7: 102,670,805 I295N probably damaging Het
Olfr559 A G 7: 102,723,725 V255A probably damaging Het
Pappa2 T A 1: 158,936,522 D473V probably damaging Het
Pou2f2 C A 7: 25,100,198 G117C probably damaging Het
Prkci A G 3: 31,025,217 H68R probably damaging Het
Pygm A G 19: 6,390,362 K479E probably damaging Het
Qpct A G 17: 79,077,567 D212G probably damaging Het
Sh3glb2 A T 2: 30,359,204 M1K probably null Het
Slc22a5 A G 11: 53,867,643 S444P probably damaging Het
Snai3 G A 8: 122,456,405 H134Y probably benign Het
Synpo T C 18: 60,602,972 D395G probably damaging Het
Tmem63c C T 12: 87,072,964 T344I probably damaging Het
Tnfsf14 A G 17: 57,190,534 Y233H Het
Ttn A G 2: 76,918,991 F3905L probably benign Het
Tubgcp5 T A 7: 55,804,615 H219Q possibly damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Vmn1r59 C T 7: 5,454,751 M3I probably benign Het
Vmn2r61 T A 7: 42,300,276 C707S probably damaging Het
Vps13b T C 15: 35,841,320 S2499P probably damaging Het
Ythdf3 A G 3: 16,205,015 E442G possibly damaging Het
Other mutations in Cnot6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Cnot6l APN 5 96086246 missense probably damaging 1.00
IGL02102:Cnot6l APN 5 96091659 missense probably damaging 0.98
BB005:Cnot6l UTSW 5 96131068 missense possibly damaging 0.95
BB015:Cnot6l UTSW 5 96131068 missense possibly damaging 0.95
R0443:Cnot6l UTSW 5 96091745 splice site probably benign
R0448:Cnot6l UTSW 5 96080046 missense probably benign 0.00
R1436:Cnot6l UTSW 5 96134112 missense probably damaging 1.00
R2198:Cnot6l UTSW 5 96079941 missense possibly damaging 0.79
R4240:Cnot6l UTSW 5 96077362 missense probably benign
R4506:Cnot6l UTSW 5 96086174 missense possibly damaging 0.93
R4624:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4627:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4629:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4868:Cnot6l UTSW 5 96083023 missense probably damaging 1.00
R4936:Cnot6l UTSW 5 96079937 missense probably damaging 1.00
R5597:Cnot6l UTSW 5 96131119 missense probably damaging 1.00
R5781:Cnot6l UTSW 5 96086165 missense probably benign 0.31
R6142:Cnot6l UTSW 5 96082978 missense probably benign 0.00
R6166:Cnot6l UTSW 5 96079940 missense possibly damaging 0.79
R6189:Cnot6l UTSW 5 96098277 missense probably benign 0.18
R6382:Cnot6l UTSW 5 96128999 missense probably damaging 0.99
R6515:Cnot6l UTSW 5 96161678 intron probably benign
R6773:Cnot6l UTSW 5 96094299 missense probably damaging 1.00
R7326:Cnot6l UTSW 5 96077299 missense probably benign 0.00
R7466:Cnot6l UTSW 5 96131128 missense probably benign 0.01
R7832:Cnot6l UTSW 5 96094225 missense possibly damaging 0.90
R7928:Cnot6l UTSW 5 96131068 missense possibly damaging 0.95
R8310:Cnot6l UTSW 5 96091676 missense probably benign
R8698:Cnot6l UTSW 5 96077290 missense probably damaging 1.00
R9029:Cnot6l UTSW 5 96098277 missense probably benign 0.18
R9100:Cnot6l UTSW 5 96083016 missense probably damaging 1.00
R9377:Cnot6l UTSW 5 96128967 missense probably benign 0.01
R9485:Cnot6l UTSW 5 96082999 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGTCCATAGCGACAGATC -3'
(R):5'- TCTACAGTCAGAGTAACAGGTATCG -3'

Sequencing Primer
(F):5'- TAGCGACAGATCCCCGTCTC -3'
(R):5'- ACAGGTATCGGGAATTACAGGTTTTC -3'
Posted On 2021-01-18