Incidental Mutation 'R6382:Gpat2'
ID515354
Institutional Source Beutler Lab
Gene Symbol Gpat2
Ensembl Gene ENSMUSG00000046338
Gene Nameglycerol-3-phosphate acyltransferase 2, mitochondrial
SynonymsGpat2, A530057A03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6382 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127425199-127436092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 127431918 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 294 (G294R)
Ref Sequence ENSEMBL: ENSMUSP00000049619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028848] [ENSMUST00000062211]
Predicted Effect probably benign
Transcript: ENSMUST00000028848
SMART Domains Protein: ENSMUSP00000028848
Gene: ENSMUSG00000027371

DomainStartEndE-ValueType
low complexity region 47 53 N/A INTRINSIC
Pfam:FAA_hydrolase 107 313 3.1e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000062211
AA Change: G294R

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049619
Gene: ENSMUSG00000046338
AA Change: G294R

DomainStartEndE-ValueType
PlsC 199 333 1.45e-11 SMART
Blast:PlsC 347 387 7e-13 BLAST
low complexity region 431 468 N/A INTRINSIC
low complexity region 515 528 N/A INTRINSIC
low complexity region 593 613 N/A INTRINSIC
low complexity region 664 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146757
Meta Mutation Damage Score 0.3984 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.5%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,600,986 M148K probably benign Het
Aldoc T C 11: 78,325,742 I242T probably benign Het
Camta2 T C 11: 70,672,041 T927A probably damaging Het
Ccdc105 G A 10: 78,752,841 T45I possibly damaging Het
Ccdc30 T C 4: 119,404,166 R25G possibly damaging Het
Cdh16 T A 8: 104,621,543 M181L possibly damaging Het
Clstn1 A T 4: 149,626,120 probably null Het
Cnot6l C A 5: 96,128,999 R110L probably damaging Het
Col7a1 G A 9: 108,975,393 S2264N unknown Het
Cspp1 A G 1: 10,083,475 probably null Het
Cul1 T A 6: 47,502,439 L213Q probably damaging Het
Cuta T C 17: 26,938,454 Q124R probably benign Het
Cyp1a1 T A 9: 57,700,690 N200K probably damaging Het
Dag1 C A 9: 108,208,137 A602S possibly damaging Het
Gm4707 G A 17: 71,459,243 probably benign Het
Gm813 T C 16: 58,613,910 E148G possibly damaging Het
H2-T23 T C 17: 36,031,832 Y138C probably damaging Het
Hnf4a A T 2: 163,569,006 M408L probably benign Het
Hpse2 A G 19: 43,388,202 L37P possibly damaging Het
Hsd17b6 A T 10: 127,991,327 I292N probably damaging Het
Hsp90aa1 A T 12: 110,695,517 probably null Het
Ifit1bl1 T A 19: 34,594,883 Y58F probably benign Het
Igkv10-95 A G 6: 68,680,688 T43A probably benign Het
Igkv6-17 C T 6: 70,371,830 Q62* probably null Het
Jakmip2 A G 18: 43,571,179 S367P possibly damaging Het
Lrrc40 A G 3: 158,058,696 D416G probably damaging Het
Mdm2 A G 10: 117,692,721 V177A probably benign Het
Mpp1 TGAGACGAACTCTCCGAG TGAG X: 75,125,769 probably null Het
Myo1b C T 1: 51,774,307 probably null Het
Notch2 A G 3: 98,141,543 D1799G probably damaging Het
Obscn C T 11: 58,999,413 G7431D unknown Het
Obscn A T 11: 59,042,208 C4781S probably damaging Het
Olfr1351 C A 10: 79,017,517 S65Y probably damaging Het
Olfr237-ps1 T A 6: 43,153,965 I220N probably damaging Het
Pard3 T A 8: 127,376,783 V411D probably damaging Het
Pfkl T C 10: 77,999,837 R246G probably damaging Het
Pgs1 T C 11: 118,003,360 Y238H probably damaging Het
Pik3c2g A G 6: 139,719,998 E15G possibly damaging Het
Pja2 A G 17: 64,309,615 V95A probably benign Het
Ripor2 T C 13: 24,677,845 I207T possibly damaging Het
Rps15 A G 10: 80,293,986 Y115C probably damaging Het
Shkbp1 C A 7: 27,352,059 E192* probably null Het
Slc23a4 T A 6: 34,957,043 M42L probably benign Het
Snx25 T A 8: 46,055,991 S373C probably benign Het
Sppl2a A T 2: 126,917,029 probably null Het
Tpcn2 A G 7: 145,269,749 S256P possibly damaging Het
Txk C T 5: 72,736,480 probably benign Het
Ubr2 C G 17: 46,957,315 W991S possibly damaging Het
Ufc1 A G 1: 171,294,675 W28R probably damaging Het
Unc93b1 C A 19: 3,935,297 A35E probably benign Het
Ush2a A G 1: 188,814,302 N3425S probably benign Het
Vmn1r32 A G 6: 66,553,361 Y144H probably benign Het
Vmn1r76 A G 7: 11,930,499 F228L probably damaging Het
Zfc3h1 A G 10: 115,407,908 N715D probably benign Het
Zfp933 T C 4: 147,825,868 S424G probably benign Het
Other mutations in Gpat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Gpat2 APN 2 127432396 missense probably benign 0.01
IGL00479:Gpat2 APN 2 127434461 missense probably damaging 0.99
IGL01393:Gpat2 APN 2 127432651 missense probably damaging 1.00
IGL01759:Gpat2 APN 2 127430896 missense possibly damaging 0.94
IGL01764:Gpat2 APN 2 127427536 missense probably benign 0.18
IGL02631:Gpat2 APN 2 127434232 splice site probably benign
IGL02657:Gpat2 APN 2 127427331 missense probably benign 0.04
IGL02813:Gpat2 APN 2 127434455 missense possibly damaging 0.90
IGL02873:Gpat2 APN 2 127431755 missense probably benign 0.00
IGL02993:Gpat2 APN 2 127427566 missense probably damaging 1.00
R6669_gpat2_048 UTSW 2 127431918 missense possibly damaging 0.90
PIT4494001:Gpat2 UTSW 2 127433880 missense probably benign 0.00
R0078:Gpat2 UTSW 2 127428249 missense probably damaging 1.00
R0230:Gpat2 UTSW 2 127435845 missense possibly damaging 0.95
R1619:Gpat2 UTSW 2 127428717 missense probably benign 0.00
R1851:Gpat2 UTSW 2 127434819 missense possibly damaging 0.77
R1939:Gpat2 UTSW 2 127435959 makesense probably null
R2143:Gpat2 UTSW 2 127433762 missense probably damaging 1.00
R2165:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R2518:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3410:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3411:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3898:Gpat2 UTSW 2 127435098 missense probably damaging 1.00
R4080:Gpat2 UTSW 2 127433622 missense probably damaging 0.99
R4725:Gpat2 UTSW 2 127431982 missense possibly damaging 0.83
R4841:Gpat2 UTSW 2 127433967 missense probably benign 0.10
R5354:Gpat2 UTSW 2 127428723 missense probably damaging 1.00
R5941:Gpat2 UTSW 2 127428275 missense possibly damaging 0.53
R6362:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6374:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6375:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6377:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6380:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6381:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6383:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6384:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6393:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6565:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6594:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6595:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6649:Gpat2 UTSW 2 127432435 missense possibly damaging 0.81
R6665:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6666:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6667:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6668:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6669:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R7031:Gpat2 UTSW 2 127435475 missense probably damaging 0.99
R7096:Gpat2 UTSW 2 127428289 missense probably benign 0.02
R7307:Gpat2 UTSW 2 127434890 missense probably damaging 1.00
R7313:Gpat2 UTSW 2 127428295 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACAACTCAGAGGGCATCCTTG -3'
(R):5'- ACATTGTGCCACCCAGAACTG -3'

Sequencing Primer
(F):5'- CATCCTTGCAAGGGCTGTG -3'
(R):5'- GGTTGATAATCTACTCGGATCCCAG -3'
Posted On2018-05-04