Incidental Mutation 'R6390:Zbtb6'
ID515718
Institutional Source Beutler Lab
Gene Symbol Zbtb6
Ensembl Gene ENSMUSG00000066798
Gene Namezinc finger and BTB domain containing 6
SynonymsA830092L04Rik, Zfp482
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R6390 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37425500-37443171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37428678 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 413 (S413T)
Ref Sequence ENSEMBL: ENSMUSP00000108554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053098] [ENSMUST00000067043] [ENSMUST00000112932]
Predicted Effect probably benign
Transcript: ENSMUST00000053098
AA Change: S413T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000056100
Gene: ENSMUSG00000066798
AA Change: S413T

DomainStartEndE-ValueType
BTB 33 127 2.67e-16 SMART
Blast:BTB 161 196 1e-5 BLAST
ZnF_C2H2 300 322 7.15e-2 SMART
ZnF_C2H2 325 347 1.58e-3 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
ZnF_C2H2 381 404 8.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067043
SMART Domains Protein: ENSMUSP00000070071
Gene: ENSMUSG00000050714

DomainStartEndE-ValueType
BTB 33 127 4.38e-12 SMART
low complexity region 169 179 N/A INTRINSIC
ZnF_C2H2 273 295 1.36e-2 SMART
ZnF_C2H2 298 320 1.4e-4 SMART
ZnF_C2H2 326 348 2.99e-4 SMART
ZnF_C2H2 354 377 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112932
AA Change: S413T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108554
Gene: ENSMUSG00000066798
AA Change: S413T

DomainStartEndE-ValueType
BTB 33 127 2.67e-16 SMART
Blast:BTB 161 196 1e-5 BLAST
ZnF_C2H2 300 322 7.15e-2 SMART
ZnF_C2H2 325 347 1.58e-3 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
ZnF_C2H2 381 404 8.81e-2 SMART
Meta Mutation Damage Score 0.0579 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg9a G T 1: 75,187,981 P113Q probably damaging Het
Ccdc150 A G 1: 54,368,017 D1073G probably benign Het
Cd8a A G 6: 71,373,929 Y126C probably damaging Het
Cdca8 A G 4: 124,936,375 M68T probably damaging Het
Cyp2d26 G A 15: 82,792,624 P174S possibly damaging Het
Esco1 T G 18: 10,567,528 N311H probably damaging Het
Evx1 A G 6: 52,315,857 M183V probably benign Het
Fam111a T G 19: 12,588,160 Y424* probably null Het
Fat4 T C 3: 38,980,380 I2727T probably damaging Het
Ggt6 T A 11: 72,436,611 Y107N possibly damaging Het
Habp2 G C 19: 56,306,823 E49Q possibly damaging Het
Hibadh A C 6: 52,556,489 L214R probably damaging Het
Ift57 T G 16: 49,762,473 probably null Het
Irak4 T C 15: 94,561,486 S328P probably damaging Het
Krtap6-2 A T 16: 89,419,946 Y44* probably null Het
Lrrc46 T C 11: 97,040,931 T22A probably damaging Het
Muc2 G T 7: 141,752,146 V230L probably damaging Het
Ncan T C 8: 70,115,249 D71G probably benign Het
Nsd2 T C 5: 33,881,181 S779P probably damaging Het
Rps6ka5 G T 12: 100,570,992 T493K probably damaging Het
Slc6a21 A T 7: 45,287,002 M135L probably benign Het
Sprtn A G 8: 124,903,219 N417S probably benign Het
Trim61 T A 8: 65,014,190 M140L probably benign Het
Vars C A 17: 35,015,639 A1148E probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r112 T C 17: 22,605,249 V495A probably benign Het
Vmn2r117 A T 17: 23,460,114 V712E possibly damaging Het
Wdfy4 T C 14: 33,104,094 D1200G probably damaging Het
Wdr63 A G 3: 146,095,388 L105P probably damaging Het
Zp2 G T 7: 120,141,230 N170K probably benign Het
Other mutations in Zbtb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Zbtb6 APN 2 37429331 missense probably benign 0.38
IGL02981:Zbtb6 APN 2 37429164 nonsense probably null
IGL03390:Zbtb6 APN 2 37429572 missense probably damaging 1.00
R0164:Zbtb6 UTSW 2 37429588 nonsense probably null
R0164:Zbtb6 UTSW 2 37429588 nonsense probably null
R0470:Zbtb6 UTSW 2 37429493 missense probably damaging 0.99
R1472:Zbtb6 UTSW 2 37429344 missense probably benign
R1606:Zbtb6 UTSW 2 37429118 missense probably benign 0.00
R1824:Zbtb6 UTSW 2 37429817 missense probably damaging 1.00
R4594:Zbtb6 UTSW 2 37429042 missense possibly damaging 0.71
R4838:Zbtb6 UTSW 2 37428716 nonsense probably null
R5000:Zbtb6 UTSW 2 37429239 missense probably benign
R5816:Zbtb6 UTSW 2 37429215 missense probably benign 0.01
R6005:Zbtb6 UTSW 2 37428965 missense probably damaging 1.00
R6152:Zbtb6 UTSW 2 37429243 missense probably benign 0.18
R7657:Zbtb6 UTSW 2 37429075 missense probably benign
R7866:Zbtb6 UTSW 2 37429565 missense probably damaging 1.00
R7949:Zbtb6 UTSW 2 37429565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACTCCTGAACAGAGGACTAATAC -3'
(R):5'- GGCCCTTTCAGTGTACTGTG -3'

Sequencing Primer
(F):5'- TAAACTTAATCACACCACCAACTTTG -3'
(R):5'- CAGTGTACTGTGTGTTTAAAGACC -3'
Posted On2018-05-04