Incidental Mutation 'R6390:Irak4'
ID515737
Institutional Source Beutler Lab
Gene Symbol Irak4
Ensembl Gene ENSMUSG00000059883
Gene Nameinterleukin-1 receptor-associated kinase 4
SynonymsIRAK-4, 8430405M07Rik, NY-REN-64, 9330209D03Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_029926; VEGA: OTTMUST00000040437; MGI: 2182474

Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock #R6390 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location94543643-94581815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94561486 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 328 (S328P)
Ref Sequence ENSEMBL: ENSMUSP00000104871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074936] [ENSMUST00000109248]
Predicted Effect probably damaging
Transcript: ENSMUST00000074936
AA Change: S328P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074471
Gene: ENSMUSG00000059883
AA Change: S328P

DomainStartEndE-ValueType
PDB:1WH4|A 1 114 1e-78 PDB
Pfam:Pkinase_Tyr 187 454 3.3e-53 PFAM
Pfam:Pkinase 187 456 4.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109248
AA Change: S328P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104871
Gene: ENSMUSG00000059883
AA Change: S328P

DomainStartEndE-ValueType
Pfam:Death 20 101 1.6e-6 PFAM
Pfam:Pkinase_Tyr 187 452 1.9e-51 PFAM
Pfam:Pkinase 188 452 1.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138306
Meta Mutation Damage Score 0.6481 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase that activates NF-kappaB in both the Toll-like receptor (TLR) and T-cell receptor (TCR) signaling pathways. The protein is essential for most innate immune responses. Mutations in this gene result in IRAK4 deficiency and recurrent invasive pneumococcal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutant mice exhibit defects of the innate immune system and show increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(5) Chemically induced(1)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg9a G T 1: 75,187,981 P113Q probably damaging Het
Ccdc150 A G 1: 54,368,017 D1073G probably benign Het
Cd8a A G 6: 71,373,929 Y126C probably damaging Het
Cdca8 A G 4: 124,936,375 M68T probably damaging Het
Cyp2d26 G A 15: 82,792,624 P174S possibly damaging Het
Esco1 T G 18: 10,567,528 N311H probably damaging Het
Evx1 A G 6: 52,315,857 M183V probably benign Het
Fam111a T G 19: 12,588,160 Y424* probably null Het
Fat4 T C 3: 38,980,380 I2727T probably damaging Het
Ggt6 T A 11: 72,436,611 Y107N possibly damaging Het
Habp2 G C 19: 56,306,823 E49Q possibly damaging Het
Hibadh A C 6: 52,556,489 L214R probably damaging Het
Ift57 T G 16: 49,762,473 probably null Het
Krtap6-2 A T 16: 89,419,946 Y44* probably null Het
Lrrc46 T C 11: 97,040,931 T22A probably damaging Het
Muc2 G T 7: 141,752,146 V230L probably damaging Het
Ncan T C 8: 70,115,249 D71G probably benign Het
Nsd2 T C 5: 33,881,181 S779P probably damaging Het
Rps6ka5 G T 12: 100,570,992 T493K probably damaging Het
Slc6a21 A T 7: 45,287,002 M135L probably benign Het
Sprtn A G 8: 124,903,219 N417S probably benign Het
Trim61 T A 8: 65,014,190 M140L probably benign Het
Vars C A 17: 35,015,639 A1148E probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r112 T C 17: 22,605,249 V495A probably benign Het
Vmn2r117 A T 17: 23,460,114 V712E possibly damaging Het
Wdfy4 T C 14: 33,104,094 D1200G probably damaging Het
Wdr63 A G 3: 146,095,388 L105P probably damaging Het
Zbtb6 A T 2: 37,428,678 S413T probably benign Het
Zp2 G T 7: 120,141,230 N170K probably benign Het
Other mutations in Irak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Irak4 APN 15 94556628 missense probably benign 0.09
IGL00688:Irak4 APN 15 94566863 missense possibly damaging 0.68
IGL01870:Irak4 APN 15 94547870 missense probably benign 0.28
IGL02740:Irak4 APN 15 94567044 makesense probably null
IGL02897:Irak4 APN 15 94553991 missense probably benign 0.00
IGL03290:Irak4 APN 15 94551899 missense probably benign 0.01
otiose UTSW 15 94561484 missense probably damaging 1.00
R0057:Irak4 UTSW 15 94553872 missense probably benign 0.00
R2010:Irak4 UTSW 15 94551806 missense probably damaging 1.00
R3751:Irak4 UTSW 15 94561595 missense probably damaging 1.00
R3752:Irak4 UTSW 15 94561595 missense probably damaging 1.00
R3753:Irak4 UTSW 15 94561595 missense probably damaging 1.00
R3973:Irak4 UTSW 15 94554740 missense possibly damaging 0.73
R4687:Irak4 UTSW 15 94566823 missense probably damaging 1.00
R4704:Irak4 UTSW 15 94566900 splice site probably null
R5001:Irak4 UTSW 15 94558273 missense possibly damaging 0.91
R5392:Irak4 UTSW 15 94556684 missense probably benign
R5392:Irak4 UTSW 15 94556685 missense probably benign 0.39
R6280:Irak4 UTSW 15 94551810 nonsense probably null
R7643:Irak4 UTSW 15 94558828 missense probably benign 0.05
R8209:Irak4 UTSW 15 94558363 missense probably damaging 1.00
R8222:Irak4 UTSW 15 94561229 splice site probably null
R8226:Irak4 UTSW 15 94558363 missense probably damaging 1.00
R8512:Irak4 UTSW 15 94566778 missense probably benign
V8831:Irak4 UTSW 15 94561484 missense probably damaging 1.00
X0019:Irak4 UTSW 15 94554000 missense probably benign 0.00
X0027:Irak4 UTSW 15 94551930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACATATAAAATGACACACAATGTG -3'
(R):5'- AAAGACTCATGCACCAAAATATTCT -3'

Sequencing Primer
(F):5'- CTGTTGGATATCCTAGGCA -3'
(R):5'- GCTTAGCAAAGTAAAGGCTCCTGC -3'
Posted On2018-05-04