Incidental Mutation 'R6390:Lrrc46'
ID515733
Institutional Source Beutler Lab
Gene Symbol Lrrc46
Ensembl Gene ENSMUSG00000020878
Gene Nameleucine rich repeat containing 46
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6390 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location97034602-97041407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97040931 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 22 (T22A)
Ref Sequence ENSEMBL: ENSMUSP00000021251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001485] [ENSMUST00000021251] [ENSMUST00000054252]
Predicted Effect probably benign
Transcript: ENSMUST00000001485
SMART Domains Protein: ENSMUSP00000001485
Gene: ENSMUSG00000001445

DomainStartEndE-ValueType
low complexity region 66 73 N/A INTRINSIC
low complexity region 109 120 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000021251
AA Change: T22A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021251
Gene: ENSMUSG00000020878
AA Change: T22A

DomainStartEndE-ValueType
SCOP:d1h6ua2 44 150 1e-15 SMART
Blast:LRR 69 91 7e-6 BLAST
low complexity region 179 191 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 265 292 N/A INTRINSIC
low complexity region 297 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054252
SMART Domains Protein: ENSMUSP00000103244
Gene: ENSMUSG00000001445

DomainStartEndE-ValueType
low complexity region 66 73 N/A INTRINSIC
low complexity region 109 120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120287
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg9a G T 1: 75,187,981 P113Q probably damaging Het
Ccdc150 A G 1: 54,368,017 D1073G probably benign Het
Cd8a A G 6: 71,373,929 Y126C probably damaging Het
Cdca8 A G 4: 124,936,375 M68T probably damaging Het
Cyp2d26 G A 15: 82,792,624 P174S possibly damaging Het
Esco1 T G 18: 10,567,528 N311H probably damaging Het
Evx1 A G 6: 52,315,857 M183V probably benign Het
Fam111a T G 19: 12,588,160 Y424* probably null Het
Fat4 T C 3: 38,980,380 I2727T probably damaging Het
Ggt6 T A 11: 72,436,611 Y107N possibly damaging Het
Habp2 G C 19: 56,306,823 E49Q possibly damaging Het
Hibadh A C 6: 52,556,489 L214R probably damaging Het
Ift57 T G 16: 49,762,473 probably null Het
Irak4 T C 15: 94,561,486 S328P probably damaging Het
Krtap6-2 A T 16: 89,419,946 Y44* probably null Het
Muc2 G T 7: 141,752,146 V230L probably damaging Het
Ncan T C 8: 70,115,249 D71G probably benign Het
Nsd2 T C 5: 33,881,181 S779P probably damaging Het
Rps6ka5 G T 12: 100,570,992 T493K probably damaging Het
Slc6a21 A T 7: 45,287,002 M135L probably benign Het
Sprtn A G 8: 124,903,219 N417S probably benign Het
Trim61 T A 8: 65,014,190 M140L probably benign Het
Vars C A 17: 35,015,639 A1148E probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r112 T C 17: 22,605,249 V495A probably benign Het
Vmn2r117 A T 17: 23,460,114 V712E possibly damaging Het
Wdfy4 T C 14: 33,104,094 D1200G probably damaging Het
Wdr63 A G 3: 146,095,388 L105P probably damaging Het
Zbtb6 A T 2: 37,428,678 S413T probably benign Het
Zp2 G T 7: 120,141,230 N170K probably benign Het
Other mutations in Lrrc46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Lrrc46 APN 11 97035875 missense probably damaging 1.00
IGL01933:Lrrc46 APN 11 97035528 missense probably benign 0.21
R0054:Lrrc46 UTSW 11 97038779 missense probably damaging 1.00
R0054:Lrrc46 UTSW 11 97038779 missense probably damaging 1.00
R0082:Lrrc46 UTSW 11 97041077 unclassified probably benign
R1104:Lrrc46 UTSW 11 97036171 missense probably damaging 1.00
R1756:Lrrc46 UTSW 11 97034730 unclassified probably benign
R2394:Lrrc46 UTSW 11 97038831 missense probably damaging 1.00
R2885:Lrrc46 UTSW 11 97034980 missense probably damaging 1.00
R2932:Lrrc46 UTSW 11 97041109 unclassified probably benign
R4361:Lrrc46 UTSW 11 97034670 unclassified probably benign
R4678:Lrrc46 UTSW 11 97034893 missense probably benign 0.37
R4989:Lrrc46 UTSW 11 97040939 missense probably damaging 1.00
R5150:Lrrc46 UTSW 11 97036131 missense probably damaging 1.00
R6467:Lrrc46 UTSW 11 97036479 missense possibly damaging 0.93
R6860:Lrrc46 UTSW 11 97035545 missense probably benign 0.05
R7373:Lrrc46 UTSW 11 97038880 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCAAGGCAGCTGAGGATGTATG -3'
(R):5'- TTTTAGATCATGCCAGGAGACG -3'

Sequencing Primer
(F):5'- TAATCCCAGCACTTGTGAGG -3'
(R):5'- TCATGCCAGGAGACGAGCAG -3'
Posted On2018-05-04