Incidental Mutation 'R4929:Olfr259'
ID381067
Institutional Source Beutler Lab
Gene Symbol Olfr259
Ensembl Gene ENSMUSG00000075160
Gene Nameolfactory receptor 259
SynonymsGA_x6K02T2N869-1820-882, MOR172-3
MMRRC Submission 042530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4929 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87104578-87114567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87108183 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 68 (F68S)
Ref Sequence ENSEMBL: ENSMUSP00000151207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099862] [ENSMUST00000213978] [ENSMUST00000215828] [ENSMUST00000216088]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099862
AA Change: F68S

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097448
Gene: ENSMUSG00000075160
AA Change: F68S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-53 PFAM
Pfam:7tm_1 41 290 5.3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213978
AA Change: F68S

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215828
AA Change: F68S

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216088
AA Change: F68S

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,574,042 noncoding transcript Het
Abcd3 A T 3: 121,768,746 probably null Het
Adamts12 C T 15: 11,259,022 R551C probably damaging Het
Adamtsl4 A G 3: 95,678,005 C818R probably damaging Het
Arfgef3 T A 10: 18,630,851 Q842L probably benign Het
Aurka A T 2: 172,370,406 V17E probably benign Het
Ccdc144b G A 3: 36,035,338 L146F probably damaging Het
Cdh24 C T 14: 54,633,516 V132I probably benign Het
Cep57l1 T C 10: 41,745,914 D2G possibly damaging Het
Cntn5 T A 9: 9,976,395 probably null Het
Col10a1 T C 10: 34,395,124 I364T probably benign Het
Dpp6 G A 5: 27,049,787 A67T probably benign Het
Dym T A 18: 75,243,286 V583E probably damaging Het
Efcab5 T G 11: 77,103,383 K1259N probably benign Het
Ehbp1 T G 11: 22,239,169 I78L possibly damaging Het
Epha1 C A 6: 42,364,599 A469S probably benign Het
Fam135a T C 1: 24,030,000 D596G probably benign Het
Filip1 T C 9: 79,819,747 N530S probably benign Het
Grhl2 A G 15: 37,360,802 N610S probably benign Het
Haus6 T C 4: 86,595,433 I331V probably benign Het
Ints2 G T 11: 86,212,653 N1192K possibly damaging Het
Itga5 A G 15: 103,353,235 V445A probably benign Het
Itga9 C A 9: 118,807,249 D82E probably damaging Het
Jam2 G A 16: 84,822,862 probably benign Het
Klhl32 T A 4: 24,709,030 I112F probably damaging Het
Lepr A G 4: 101,815,117 I1113V probably benign Het
Lrrc3b C A 14: 15,357,888 L239F probably damaging Het
Lzic T A 4: 149,488,128 probably null Het
Mxra8 T A 4: 155,842,661 F351I probably damaging Het
Naa40 A G 19: 7,229,982 F126L probably damaging Het
Nbeal1 C T 1: 60,238,654 S733F probably damaging Het
Olfr183 A C 16: 59,000,219 Y178S probably damaging Het
Olfr686 A G 7: 105,204,025 I106T probably damaging Het
Olr1 T C 6: 129,500,081 T74A probably damaging Het
Pgam5 A T 5: 110,265,825 V130D probably damaging Het
Pop4 A G 7: 38,266,149 C115R probably damaging Het
Prpf18 A T 2: 4,624,537 probably null Het
Psg16 G A 7: 17,095,106 R205H possibly damaging Het
Ptgr1 C A 4: 58,981,879 A53S probably benign Het
Shank2 A G 7: 144,411,271 D1451G probably benign Het
Slfn10-ps A G 11: 83,029,519 noncoding transcript Het
Sox8 G A 17: 25,570,356 A56V probably benign Het
Ssr3 A G 3: 65,387,754 S113P probably damaging Het
Stx16 T C 2: 174,096,928 Y296H possibly damaging Het
Tfcp2 A T 15: 100,528,489 N60K probably benign Het
Thada T C 17: 84,444,226 T441A probably benign Het
Trf G T 9: 103,227,875 probably benign Het
Vamp2 T A 11: 69,088,662 probably benign Het
Vmn2r105 A T 17: 20,228,018 D181E probably benign Het
Vmn2r12 A T 5: 109,091,678 Y340N probably damaging Het
Wasf2 C A 4: 133,195,859 D493E unknown Het
Wdfy4 T C 14: 33,047,256 D2084G possibly damaging Het
Zfp229 T A 17: 21,746,373 I528N probably damaging Het
Zfp703 T A 8: 26,978,851 V181E possibly damaging Het
Other mutations in Olfr259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02264:Olfr259 APN 2 87107441 utr 3 prime probably benign
IGL02540:Olfr259 APN 2 87108042 missense probably damaging 1.00
IGL02572:Olfr259 APN 2 87108366 missense possibly damaging 0.63
R2091:Olfr259 UTSW 2 87108262 missense probably damaging 1.00
R2928:Olfr259 UTSW 2 87107763 missense possibly damaging 0.88
R4107:Olfr259 UTSW 2 87107655 missense probably damaging 1.00
R4332:Olfr259 UTSW 2 87107745 missense possibly damaging 0.79
R5027:Olfr259 UTSW 2 87107806 missense probably benign 0.40
R6005:Olfr259 UTSW 2 87108063 missense probably benign 0.00
R6191:Olfr259 UTSW 2 87107952 missense probably damaging 1.00
R6358:Olfr259 UTSW 2 87108434 start gained probably benign
R6399:Olfr259 UTSW 2 87107986 missense probably benign 0.21
R6554:Olfr259 UTSW 2 87107626 missense probably benign 0.34
R7836:Olfr259 UTSW 2 87107517 missense probably damaging 1.00
R7881:Olfr259 UTSW 2 87108057 missense probably damaging 0.99
R7919:Olfr259 UTSW 2 87107517 missense probably damaging 1.00
R7964:Olfr259 UTSW 2 87108057 missense probably damaging 0.99
R8069:Olfr259 UTSW 2 87108067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGATTTGCAATTGCCAC -3'
(R):5'- CTACTGAAAGCATGGGAATTCGG -3'

Sequencing Primer
(F):5'- GGGATTTGCAATTGCCACATAGC -3'
(R):5'- GCATGGGAATTCGGAATCATAC -3'
Posted On2016-04-15