Incidental Mutation 'R6473:Gba'
ID520326
Institutional Source Beutler Lab
Gene Symbol Gba
Ensembl Gene ENSMUSG00000028048
Gene Nameglucosidase, beta, acid
Synonymsglucocerebrosidase, GCase, GC, betaGC, GBA1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R6473 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89202928-89208966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89204081 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 51 (P51L)
Ref Sequence ENSEMBL: ENSMUSP00000130660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073572] [ENSMUST00000077367] [ENSMUST00000167998] [ENSMUST00000197738]
Predicted Effect probably benign
Transcript: ENSMUST00000073572
SMART Domains Protein: ENSMUSP00000073261
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 4.2e-21 PFAM
Pfam:Tom37_C 239 317 8.1e-24 PFAM
Pfam:GST_C_3 267 383 1.7e-11 PFAM
Pfam:GST_C_2 270 377 2.7e-8 PFAM
Pfam:Tom37_C 300 369 1.1e-14 PFAM
low complexity region 396 415 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077367
AA Change: P51L

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076589
Gene: ENSMUSG00000028048
AA Change: P51L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 512 1.4e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167998
AA Change: P51L

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130660
Gene: ENSMUSG00000028048
AA Change: P51L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 512 1.4e-252 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196887
Predicted Effect probably benign
Transcript: ENSMUST00000197738
AA Change: P51L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142401
Gene: ENSMUSG00000028048
AA Change: P51L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 388 1e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200124
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mutations in this locus variably lower enzyme activity and result in accumulated glucocerebroside in reticuloendotehelial cell lysosomes and glucosylceramide in brain, liver and skin. Severe mutants die perinatally with compromised epidermal permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,799,643 D106G probably damaging Het
Adat3 A G 10: 80,606,967 D213G probably damaging Het
Akt1 T C 12: 112,662,260 D32G probably damaging Het
Ampd1 C T 3: 103,095,646 R61* probably null Het
Ash2l T A 8: 25,834,980 T184S probably damaging Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Chmp2b C T 16: 65,546,872 G96S probably damaging Het
Cyp2d26 T C 15: 82,791,767 N248S probably benign Het
Cyp46a1 G T 12: 108,355,475 R320L possibly damaging Het
Dact1 A G 12: 71,317,698 T418A probably benign Het
Ddx3y T C Y: 1,265,971 Y342C possibly damaging Homo
Dnm3 T A 1: 162,477,705 Q40L probably damaging Het
Eif2s1 T C 12: 78,881,225 I225T probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eps8 A T 6: 137,479,098 I795N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw7 T C 3: 84,952,380 probably benign Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Kalrn A G 16: 34,205,302 I551T probably damaging Het
Madd T C 2: 91,167,059 T755A probably benign Het
Mrps31 A G 8: 22,414,865 D90G probably benign Het
Olfr115 T A 17: 37,609,996 T252S possibly damaging Het
Olfr191 A T 16: 59,086,043 L147M probably benign Het
P2ry12 T A 3: 59,217,511 I248F probably benign Het
Ptgfrn T C 3: 101,045,639 R760G probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Slpi T C 2: 164,354,926 Y116C probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Terb1 T A 8: 104,473,037 E425V probably damaging Het
Thbs2 A G 17: 14,685,796 S281P probably benign Het
Tnik A G 3: 28,263,643 M1V probably null Het
Usp16 G A 16: 87,483,135 S741N probably benign Het
Usp48 T C 4: 137,609,108 probably null Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Vmn1r21 A T 6: 57,843,598 I287K probably damaging Het
Zfp157 T C 5: 138,455,926 C129R probably damaging Het
Other mutations in Gba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Gba APN 3 89205841 missense probably damaging 1.00
IGL02661:Gba APN 3 89203527 missense probably benign 0.02
IGL02832:Gba APN 3 89203502 missense probably benign
R0308:Gba UTSW 3 89208364 missense probably benign 0.00
R0811:Gba UTSW 3 89204000 missense probably benign 0.01
R0812:Gba UTSW 3 89204000 missense probably benign 0.01
R1517:Gba UTSW 3 89206148 missense probably damaging 1.00
R2119:Gba UTSW 3 89205561 missense probably benign 0.11
R4613:Gba UTSW 3 89208644 utr 3 prime probably null
R5371:Gba UTSW 3 89205471 missense probably benign 0.37
R5987:Gba UTSW 3 89205822 missense probably damaging 0.98
R6469:Gba UTSW 3 89204081 missense probably benign 0.12
R6470:Gba UTSW 3 89204081 missense probably benign 0.12
R6474:Gba UTSW 3 89204081 missense probably benign 0.12
R6475:Gba UTSW 3 89205928 missense probably benign 0.00
R6483:Gba UTSW 3 89208603 missense probably damaging 1.00
R7190:Gba UTSW 3 89204362 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCTCGTACCTAGCATGC -3'
(R):5'- GAACTTCTTTTCTGGCTGCAAAG -3'

Sequencing Primer
(F):5'- GTACCTAGCATGCCCACTC -3'
(R):5'- TTCTGGCTGCAAAGTGAGTAGTAAC -3'
Posted On2018-06-06