Mutagenetix > Incidental Mutations

Incidental Mutation 'R6473:Thbs2'

520376

Institutional Source

Beutler Lab

Gene Symbol

Thbs2

Ensembl Gene

ENSMUSG00000023885

Gene Name

thrombospondin 2

Synonyms

Thbs-2, Thrombospondin-2, TSP2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R6473 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14665500-14694235 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 14685796 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 281 (S281P)

Ref Sequence

ENSEMBL: ENSMUSP00000128308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170872]

Predicted Effect

probably benign
Transcript: ENSMUST00000170872
AA Change: S281P

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: S281P

Domain	Start	End	E-Value	Type
low complexity region	2	10	N/A	INTRINSIC
TSPN	21	215	3.8e-60	SMART
VWC	320	374	3.55e-19	SMART
TSP1	384	431	3.36e-11	SMART
TSP1	440	492	1.35e-15	SMART
TSP1	497	549	8.6e-18	SMART
EGF	552	589	6.3e-3	SMART
EGF	593	647	1.56e1	SMART
EGF	651	692	2.19e-2	SMART
Pfam:TSP_3	729	764	2.5e-12	PFAM
Pfam:TSP_3	763	787	7.4e-7	PFAM
Pfam:TSP_3	788	823	9.4e-12	PFAM
Pfam:TSP_3	823	846	4.1e-7	PFAM
Pfam:TSP_3	847	884	1.7e-12	PFAM
Pfam:TSP_3	885	920	1.3e-11	PFAM
Pfam:TSP_3	921	956	3.1e-11	PFAM
Pfam:TSP_C	974	1171	1e-98	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 96.9%
20x: 89.9%

Validation Efficiency

95% (36/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	T	C	16: 85,799,643	D106G	probably damaging	Het
Adat3	A	G	10: 80,606,967	D213G	probably damaging	Het
Akt1	T	C	12: 112,662,260	D32G	probably damaging	Het
Ampd1	C	T	3: 103,095,646	R61*	probably null	Het
Ash2l	T	A	8: 25,834,980	T184S	probably damaging	Het
B3galnt1	T	C	3: 69,575,340	N196S	possibly damaging	Het
Chmp2b	C	T	16: 65,546,872	G96S	probably damaging	Het
Cyp2d26	T	C	15: 82,791,767	N248S	probably benign	Het
Cyp46a1	G	T	12: 108,355,475	R320L	possibly damaging	Het
Dact1	A	G	12: 71,317,698	T418A	probably benign	Het
Ddx3y	T	C	Y: 1,265,971	Y342C	possibly damaging	Homo
Dnm3	T	A	1: 162,477,705	Q40L	probably damaging	Het
Eif2s1	T	C	12: 78,881,225	I225T	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Eps8	A	T	6: 137,479,098	I795N	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fbxw7	T	C	3: 84,952,380		probably benign	Het
Gba	C	T	3: 89,204,081	P51L	probably benign	Het
Idh3b	AG	AGCACCACAACTG	2: 130,279,673		probably null	Het
Kalrn	A	G	16: 34,205,302	I551T	probably damaging	Het
Madd	T	C	2: 91,167,059	T755A	probably benign	Het
Mrps31	A	G	8: 22,414,865	D90G	probably benign	Het
Olfr115	T	A	17: 37,609,996	T252S	possibly damaging	Het
Olfr191	A	T	16: 59,086,043	L147M	probably benign	Het
P2ry12	T	A	3: 59,217,511	I248F	probably benign	Het
Ptgfrn	T	C	3: 101,045,639	R760G	probably damaging	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Homo
Slpi	T	C	2: 164,354,926	Y116C	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Terb1	T	A	8: 104,473,037	E425V	probably damaging	Het
Tnik	A	G	3: 28,263,643	M1V	probably null	Het
Usp16	G	A	16: 87,483,135	S741N	probably benign	Het
Usp48	T	C	4: 137,609,108		probably null	Het
Vipr1	T	C	9: 121,668,555	S380P	probably damaging	Het
Vmn1r21	A	T	6: 57,843,598	I287K	probably damaging	Het
Zfp157	T	C	5: 138,455,926	C129R	probably damaging	Het

Other mutations in Thbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Thbs2	APN	17	14668835	missense	probably damaging	1.00
IGL00764:Thbs2	APN	17	14690252	missense	probably damaging	0.98
IGL01370:Thbs2	APN	17	14690065	missense	possibly damaging	0.82
IGL01604:Thbs2	APN	17	14678769	missense	probably benign	0.31
IGL01936:Thbs2	APN	17	14687814	missense	probably benign	0.00
IGL02061:Thbs2	APN	17	14679914	missense	probably benign	0.35
IGL02255:Thbs2	APN	17	14689785	missense	probably benign	0.00
IGL02342:Thbs2	APN	17	14676316	missense	probably damaging	1.00
IGL02402:Thbs2	APN	17	14671454	missense	probably benign	0.01
IGL02499:Thbs2	APN	17	14684066	splice site	probably benign
IGL02572:Thbs2	APN	17	14677013	missense	possibly damaging	0.72
IGL02701:Thbs2	APN	17	14683361	missense	probably benign	0.05
IGL02871:Thbs2	APN	17	14685786	missense	probably benign
IGL03058:Thbs2	APN	17	14689969	missense	possibly damaging	0.91
IGL03185:Thbs2	APN	17	14681410	nonsense	probably null
IGL03232:Thbs2	APN	17	14691413	start codon destroyed	probably null
IGL03289:Thbs2	APN	17	14690122	missense	probably benign	0.00
IGL03407:Thbs2	APN	17	14673273	missense	probably benign	0.00
H8562:Thbs2	UTSW	17	14671453	missense	probably benign	0.00
IGL02802:Thbs2	UTSW	17	14684127	missense	probably benign	0.01
PIT4354001:Thbs2	UTSW	17	14689968	missense	probably damaging	0.99
R0088:Thbs2	UTSW	17	14681701	missense	possibly damaging	0.96
R0167:Thbs2	UTSW	17	14667525	splice site	probably benign
R0415:Thbs2	UTSW	17	14679973	missense	probably benign
R0658:Thbs2	UTSW	17	14680325	missense	probably benign	0.00
R0735:Thbs2	UTSW	17	14679815	missense	probably benign	0.00
R1582:Thbs2	UTSW	17	14671288	missense	probably damaging	1.00
R1585:Thbs2	UTSW	17	14689768	missense	probably benign	0.00
R1608:Thbs2	UTSW	17	14685781	missense	probably benign
R1721:Thbs2	UTSW	17	14678810	missense	probably benign	0.00
R1724:Thbs2	UTSW	17	14685900	missense	possibly damaging	0.80
R1791:Thbs2	UTSW	17	14685813	missense	probably benign
R1816:Thbs2	UTSW	17	14670713	missense	probably benign	0.01
R1816:Thbs2	UTSW	17	14670714	missense	probably benign	0.00
R1911:Thbs2	UTSW	17	14689842	missense	probably benign	0.38
R2137:Thbs2	UTSW	17	14673306	missense	probably damaging	1.00
R2152:Thbs2	UTSW	17	14673209	missense	probably damaging	1.00
R2244:Thbs2	UTSW	17	14671413	missense	probably damaging	1.00
R2325:Thbs2	UTSW	17	14690289	splice site	probably null
R2509:Thbs2	UTSW	17	14685843	missense	probably benign	0.11
R3838:Thbs2	UTSW	17	14687851	missense	probably benign
R4173:Thbs2	UTSW	17	14681631	splice site	probably null
R4427:Thbs2	UTSW	17	14680335	missense	probably benign
R4495:Thbs2	UTSW	17	14671413	missense	probably damaging	1.00
R4789:Thbs2	UTSW	17	14671488	missense	probably damaging	1.00
R4928:Thbs2	UTSW	17	14678900	missense	probably damaging	1.00
R5058:Thbs2	UTSW	17	14676329	missense	probably damaging	1.00
R5112:Thbs2	UTSW	17	14670590	splice site	probably null
R5619:Thbs2	UTSW	17	14681244	missense	probably damaging	1.00
R5649:Thbs2	UTSW	17	14689953	missense	probably damaging	1.00
R5664:Thbs2	UTSW	17	14689837	missense	probably damaging	1.00
R5801:Thbs2	UTSW	17	14687863	missense	probably damaging	1.00
R5816:Thbs2	UTSW	17	14684071	critical splice donor site	probably null
R5840:Thbs2	UTSW	17	14681430	splice site	probably null
R6149:Thbs2	UTSW	17	14679680	critical splice donor site	probably null
R6166:Thbs2	UTSW	17	14680388	missense	probably damaging	1.00
R6412:Thbs2	UTSW	17	14677077	missense	probably damaging	1.00
R6640:Thbs2	UTSW	17	14673368	missense	possibly damaging	0.94
R6695:Thbs2	UTSW	17	14674164	missense	possibly damaging	0.54
R6711:Thbs2	UTSW	17	14690265	missense	probably benign	0.00
R6947:Thbs2	UTSW	17	14689767	missense	possibly damaging	0.79
R6962:Thbs2	UTSW	17	14681820	missense	probably benign	0.00
R7183:Thbs2	UTSW	17	14690116	missense	possibly damaging	0.90
R7203:Thbs2	UTSW	17	14671458	missense	probably damaging	1.00
R7386:Thbs2	UTSW	17	14673150	missense	possibly damaging	0.95
R7621:Thbs2	UTSW	17	14674164	missense	probably benign
R7747:Thbs2	UTSW	17	14670039	missense	possibly damaging	0.94
R7759:Thbs2	UTSW	17	14677059	missense	probably damaging	1.00
R7800:Thbs2	UTSW	17	14676296	missense	probably damaging	1.00
R7895:Thbs2	UTSW	17	14676221	missense	probably damaging	1.00
R8094:Thbs2	UTSW	17	14680322	missense	probably benign	0.00
R8332:Thbs2	UTSW	17	14679770	missense	probably damaging	1.00
R8478:Thbs2	UTSW	17	14680404	missense	probably benign	0.00
S24628:Thbs2	UTSW	17	14679973	missense	probably benign
X0025:Thbs2	UTSW	17	14681800	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGAAGTATTGGTCCCCAGAGGC -3'
(R):5'- CAGCTTACAGTTGCAAGCCTG -3'

Sequencing Primer
(F):5'- TCCCCAGAGGCCTGACTG -3'
(R):5'- AGAGACTGTGCTCCGCTATAATTC -3'

Posted On

2018-06-06