Incidental Mutation 'R6541:Iba57'
ID520780
Institutional Source Beutler Lab
Gene Symbol Iba57
Ensembl Gene ENSMUSG00000049287
Gene NameIBA57 homolog, iron-sulfur cluster assembly
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.487) question?
Stock #R6541 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location59155369-59163739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59158863 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 219 (D219E)
Ref Sequence ENSEMBL: ENSMUSP00000049823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054523] [ENSMUST00000069631] [ENSMUST00000137433]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054523
AA Change: D219E

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049823
Gene: ENSMUSG00000049287
AA Change: D219E

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:GCV_T_C 259 352 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069631
SMART Domains Protein: ENSMUSP00000065882
Gene: ENSMUSG00000049287

DomainStartEndE-ValueType
low complexity region 81 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137433
SMART Domains Protein: ENSMUSP00000114501
Gene: ENSMUSG00000049287

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:GCV_T 50 148 7.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the mitochondrion and is part of the iron-sulfur cluster assembly pathway. The encoded protein functions late in the biosynthesis of mitochondrial 4Fe-4S proteins. Defects in this gene have been associated with autosomal recessive spastic paraplegia-74 and with multiple mitochondrial dysfunctions syndrome-3. Two transcript variants encoding different isoforms have been found for this gene. The smaller isoform is not likely to be localized to the mitochondrion since it lacks the amino-terminal transit peptide. [provided by RefSeq, Jul 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,662,613 Q79L probably benign Het
2410089E03Rik T C 15: 8,219,295 V1776A possibly damaging Het
Ass1 T C 2: 31,510,233 V321A probably damaging Het
BC028528 T A 3: 95,888,218 M91L probably benign Het
Bicra T C 7: 15,979,129 T998A probably benign Het
Cdkl3 T G 11: 52,022,744 L220R probably damaging Het
Cluh A G 11: 74,657,214 D117G probably damaging Het
Crygf T C 1: 65,928,065 F116S probably damaging Het
Ergic2 T A 6: 148,183,150 Y20F probably damaging Het
Esf1 A G 2: 140,167,879 V179A probably benign Het
Gm28360 T C 1: 117,830,317 probably benign Het
Hhatl C T 9: 121,785,144 V385I probably damaging Het
Il1f8 T A 2: 24,159,815 V146D probably damaging Het
Itgal T A 7: 127,311,562 V176E probably damaging Het
Kdm3a T C 6: 71,594,533 M1060V possibly damaging Het
Kif18b T C 11: 102,914,266 K351R probably damaging Het
Mroh9 A G 1: 163,058,038 F342L possibly damaging Het
Ndufa11 T A 17: 56,717,867 S10T probably benign Het
Olfr1152 T C 2: 87,868,294 F101S probably benign Het
Olfr1344 A T 7: 6,440,493 N198Y probably benign Het
Olfr711 A T 7: 106,972,203 F47Y probably benign Het
Olfr871 T A 9: 20,212,399 F17I probably benign Het
Pacsin3 A G 2: 91,262,784 E207G probably damaging Het
Pcsk1 T A 13: 75,125,984 L136Q probably damaging Het
Prr18 G T 17: 8,341,336 R108L possibly damaging Het
Rdh5 A G 10: 128,918,108 V44A possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sh2d4b T C 14: 40,820,791 T343A probably benign Het
Slc16a10 T C 10: 40,037,272 N480S probably benign Het
Sval3 A T 6: 41,972,446 N73Y probably damaging Het
Taar7d T C 10: 24,028,231 I337T probably benign Het
Ttn T A 2: 76,746,695 Q24618L possibly damaging Het
Ugt1a9 T A 1: 88,071,596 V256E probably damaging Het
Vmn2r108 T A 17: 20,481,218 I7F probably benign Het
Vmn2r55 A G 7: 12,671,012 S155P probably damaging Het
Vwa3b T A 1: 37,051,761 V169E probably damaging Het
Other mutations in Iba57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Iba57 APN 11 59158949 missense probably damaging 1.00
IGL02496:Iba57 APN 11 59158946 missense probably benign 0.26
FR4737:Iba57 UTSW 11 59161505 frame shift probably null
R0052:Iba57 UTSW 11 59158901 missense probably benign 0.06
R0103:Iba57 UTSW 11 59163613 missense probably benign 0.01
R0467:Iba57 UTSW 11 59163439 missense probably benign 0.03
R4540:Iba57 UTSW 11 59163078 intron probably benign
R4626:Iba57 UTSW 11 59158461 missense probably benign 0.01
R6344:Iba57 UTSW 11 59158293 missense probably damaging 1.00
R6711:Iba57 UTSW 11 59158543 missense probably damaging 1.00
R6807:Iba57 UTSW 11 59158614 missense probably damaging 1.00
RF011:Iba57 UTSW 11 59163612 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCGTGTCCAGAGAGAAGAAC -3'
(R):5'- TCCATGTACAAGATCCGGCG -3'

Sequencing Primer
(F):5'- CAGGCCTGCAGTTTATAAAGC -3'
(R):5'- TCACCGTGGAGCCAAGTC -3'
Posted On2018-06-06