Mutagenetix > Incidental Mutation

Incidental Mutation 'R6541:Cluh'

520782

Institutional Source

Beutler Lab

Gene Symbol

Cluh

Ensembl Gene

ENSMUSG00000020741

Gene Name

clustered mitochondria (cluA/CLU1) homolog

Synonyms

1300001I01Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.292) question?

Stock #

R6541 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74649495-74670847 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74657214 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 117 (D117G)

Ref Sequence

ENSEMBL: ENSMUSP00000113371 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092915
AA Change: D117G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741
AA Change: D117G

Domain	Start	End	E-Value	Type
Pfam:CLU_N	104	177	3.1e-28	PFAM
Pfam:CLU	394	614	3.4e-89	PFAM
Pfam:eIF3_p135	806	988	1.3e-58	PFAM
Pfam:TPR_10	1059	1100	2.9e-7	PFAM
low complexity region	1114	1125	N/A	INTRINSIC
Pfam:TPR_12	1140	1218	1.7e-10	PFAM
low complexity region	1316	1334	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117818
AA Change: D117G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741
AA Change: D117G

Domain	Start	End	E-Value	Type
Pfam:CLU_N	102	177	9.8e-30	PFAM
Pfam:CLU	394	615	5.3e-92	PFAM
Pfam:eIF3_p135	796	938	2.9e-38	PFAM
Pfam:TPR_10	1008	1049	9.5e-7	PFAM
low complexity region	1063	1074	N/A	INTRINSIC
Pfam:TPR_12	1089	1167	1.1e-9	PFAM
low complexity region	1265	1283	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127679

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130398

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155558

Meta Mutation Damage Score

0.7244

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

97% (36/37)

MGI Phenotype

PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016D06Rik	T	A	8: 11,662,613	Q79L	probably benign	Het
2410089E03Rik	T	C	15: 8,219,295	V1776A	possibly damaging	Het
Ass1	T	C	2: 31,510,233	V321A	probably damaging	Het
BC028528	T	A	3: 95,888,218	M91L	probably benign	Het
Bicra	T	C	7: 15,979,129	T998A	probably benign	Het
Cdkl3	T	G	11: 52,022,744	L220R	probably damaging	Het
Crygf	T	C	1: 65,928,065	F116S	probably damaging	Het
Ergic2	T	A	6: 148,183,150	Y20F	probably damaging	Het
Esf1	A	G	2: 140,167,879	V179A	probably benign	Het
Gm28360	T	C	1: 117,830,317		probably benign	Het
Hhatl	C	T	9: 121,785,144	V385I	probably damaging	Het
Iba57	A	T	11: 59,158,863	D219E	possibly damaging	Het
Il1f8	T	A	2: 24,159,815	V146D	probably damaging	Het
Itgal	T	A	7: 127,311,562	V176E	probably damaging	Het
Kdm3a	T	C	6: 71,594,533	M1060V	possibly damaging	Het
Kif18b	T	C	11: 102,914,266	K351R	probably damaging	Het
Mroh9	A	G	1: 163,058,038	F342L	possibly damaging	Het
Ndufa11	T	A	17: 56,717,867	S10T	probably benign	Het
Olfr1152	T	C	2: 87,868,294	F101S	probably benign	Het
Olfr1344	A	T	7: 6,440,493	N198Y	probably benign	Het
Olfr711	A	T	7: 106,972,203	F47Y	probably benign	Het
Olfr871	T	A	9: 20,212,399	F17I	probably benign	Het
Pacsin3	A	G	2: 91,262,784	E207G	probably damaging	Het
Pcsk1	T	A	13: 75,125,984	L136Q	probably damaging	Het
Prr18	G	T	17: 8,341,336	R108L	possibly damaging	Het
Rdh5	A	G	10: 128,918,108	V44A	possibly damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Sh2d4b	T	C	14: 40,820,791	T343A	probably benign	Het
Slc16a10	T	C	10: 40,037,272	N480S	probably benign	Het
Sval3	A	T	6: 41,972,446	N73Y	probably damaging	Het
Taar7d	T	C	10: 24,028,231	I337T	probably benign	Het
Ttn	T	A	2: 76,746,695	Q24618L	possibly damaging	Het
Ugt1a9	T	A	1: 88,071,596	V256E	probably damaging	Het
Vmn2r108	T	A	17: 20,481,218	I7F	probably benign	Het
Vmn2r55	A	G	7: 12,671,012	S155P	probably damaging	Het
Vwa3b	T	A	1: 37,051,761	V169E	probably damaging	Het

Other mutations in Cluh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cluh	APN	11	74664064	missense	probably benign	0.28
IGL00858:Cluh	APN	11	74659605	missense	possibly damaging	0.86
IGL01380:Cluh	APN	11	74665946	missense	probably benign	0.04
IGL02402:Cluh	APN	11	74657171	missense	probably damaging	1.00
IGL02620:Cluh	APN	11	74665067	nonsense	probably null
IGL02990:Cluh	APN	11	74667765	splice site	probably null
IGL03163:Cluh	APN	11	74666068	missense	probably benign	0.44
IGL03208:Cluh	APN	11	74669506	splice site	probably null
IGL03293:Cluh	APN	11	74665752	missense	probably benign	0.03
IGL03408:Cluh	APN	11	74665953	missense	probably benign	0.06
spent	UTSW	11	74660372	missense	probably damaging	1.00
FR4342:Cluh	UTSW	11	74669524	small insertion	probably benign
FR4342:Cluh	UTSW	11	74669526	small insertion	probably benign
FR4449:Cluh	UTSW	11	74669532	small insertion	probably benign
FR4589:Cluh	UTSW	11	74669531	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669514	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669519	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669524	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669533	small insertion	probably benign
FR4976:Cluh	UTSW	11	74669520	small insertion	probably benign
R0147:Cluh	UTSW	11	74665938	missense	probably damaging	1.00
R0153:Cluh	UTSW	11	74657350	splice site	probably benign
R0506:Cluh	UTSW	11	74664894	missense	probably benign	0.20
R0526:Cluh	UTSW	11	74665986	missense	probably benign	0.05
R0834:Cluh	UTSW	11	74663805	missense	probably benign	0.02
R1873:Cluh	UTSW	11	74662076	missense	possibly damaging	0.72
R1991:Cluh	UTSW	11	74659529	nonsense	probably null
R1992:Cluh	UTSW	11	74660002	missense	probably damaging	1.00
R2095:Cluh	UTSW	11	74661724	nonsense	probably null
R2101:Cluh	UTSW	11	74660502	splice site	probably benign
R2103:Cluh	UTSW	11	74659529	nonsense	probably null
R2220:Cluh	UTSW	11	74667121	missense	probably damaging	1.00
R3702:Cluh	UTSW	11	74665356	missense	probably benign
R3853:Cluh	UTSW	11	74656453	missense	probably benign	0.00
R3900:Cluh	UTSW	11	74667104	missense	probably benign	0.29
R4891:Cluh	UTSW	11	74665059	missense	possibly damaging	0.51
R4895:Cluh	UTSW	11	74667405	missense	probably damaging	1.00
R5056:Cluh	UTSW	11	74661946	missense	probably damaging	1.00
R5089:Cluh	UTSW	11	74660372	missense	probably damaging	1.00
R5217:Cluh	UTSW	11	74659705	missense	probably damaging	1.00
R5346:Cluh	UTSW	11	74665218	missense	probably damaging	1.00
R5382:Cluh	UTSW	11	74665109	intron	probably benign
R5516:Cluh	UTSW	11	74660444	missense	probably damaging	1.00
R5809:Cluh	UTSW	11	74661700	missense	probably damaging	1.00
R6146:Cluh	UTSW	11	74667228	splice site	probably null
R6326:Cluh	UTSW	11	74666242	missense	probably benign	0.10
R6674:Cluh	UTSW	11	74666227	missense	probably damaging	1.00
R6870:Cluh	UTSW	11	74665384	missense	probably damaging	1.00
R6875:Cluh	UTSW	11	74661918	missense	probably damaging	1.00
R7086:Cluh	UTSW	11	74667340	missense	possibly damaging	0.46
R7225:Cluh	UTSW	11	74666406	splice site	probably null
R7310:Cluh	UTSW	11	74669459	missense	probably benign	0.10
R7317:Cluh	UTSW	11	74665704	missense	possibly damaging	0.90
R7674:Cluh	UTSW	11	74667720	missense	probably damaging	1.00
R7941:Cluh	UTSW	11	74659757	missense	probably benign	0.00
R9061:Cluh	UTSW	11	74660366	missense	possibly damaging	0.73
R9326:Cluh	UTSW	11	74664076	missense	probably benign	0.00
R9489:Cluh	UTSW	11	74667946	missense	possibly damaging	0.92
R9605:Cluh	UTSW	11	74667946	missense	possibly damaging	0.92
RF020:Cluh	UTSW	11	74669538	small insertion	probably benign
RF032:Cluh	UTSW	11	74669515	small insertion	probably benign
X0028:Cluh	UTSW	11	74663466	missense	probably benign	0.26
Z1177:Cluh	UTSW	11	74667754	missense	possibly damaging	0.82
Z1186:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1186:Cluh	UTSW	11	74669531	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669514	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669516	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669520	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669521	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669524	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669529	small insertion	probably benign
Z1188:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669514	frame shift	probably null
Z1189:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669519	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669523	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669529	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669530	nonsense	probably null
Z1189:Cluh	UTSW	11	74669531	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669518	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669530	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669532	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669514	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669523	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669526	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669530	small insertion	probably benign
Z1192:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1192:Cluh	UTSW	11	74669525	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAATATGGTATTCCTGGATAGGGC -3'
(R):5'- GGATATCTGGCCTAACTCTGGG -3'

Sequencing Primer
(F):5'- CCTGGATAGGGCTGGAATTG -3'
(R):5'- AACTCTGGGGCCCTCCTC -3'

Posted On

2018-06-06