Incidental Mutation 'R6596:Tbc1d16'
ID525998
Institutional Source Beutler Lab
Gene Symbol Tbc1d16
Ensembl Gene ENSMUSG00000039976
Gene NameTBC1 domain family, member 16
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6596 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location119143045-119228499 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 119157775 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 351 (W351G)
Ref Sequence ENSEMBL: ENSMUSP00000147182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036113] [ENSMUST00000207655]
Predicted Effect probably damaging
Transcript: ENSMUST00000036113
AA Change: W351G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048516
Gene: ENSMUSG00000039976
AA Change: W351G

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Blast:TBC 63 362 5e-75 BLAST
Blast:TBC 373 418 2e-13 BLAST
TBC 421 659 4.39e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183965
Predicted Effect probably damaging
Transcript: ENSMUST00000207655
AA Change: W351G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,942,785 C135S possibly damaging Het
Bag4 C T 8: 25,769,500 D224N probably damaging Het
Cldn15 T A 5: 136,974,679 C178* probably null Het
Col7a1 C A 9: 108,954,341 probably benign Het
Crnn G A 3: 93,146,875 E22K probably damaging Het
Dcstamp A C 15: 39,754,209 T5P possibly damaging Het
Dennd4a A G 9: 64,852,420 Y269C probably damaging Het
Dsg1c T A 18: 20,270,524 probably null Het
Duox2 C T 2: 122,285,338 V972I probably benign Het
Ephb1 A C 9: 102,194,802 Y259* probably null Het
Fam149a G T 8: 45,381,630 T44K probably benign Het
Fn1 A G 1: 71,609,482 Y1423H probably damaging Het
Garem1 T A 18: 21,148,739 I187F probably damaging Het
Gfm2 C T 13: 97,165,149 P487S probably damaging Het
Gm5039 C A 12: 88,321,287 L65F possibly damaging Het
Hyou1 A G 9: 44,387,755 E625G probably benign Het
Kmt5a G A 5: 124,450,696 V121M probably benign Het
Mindy4 T C 6: 55,224,016 S229P probably damaging Het
Muc16 T C 9: 18,566,715 D7098G probably benign Het
Nsf A T 11: 103,910,457 I244N probably damaging Het
Obox1 C T 7: 15,555,376 S72L probably damaging Het
Olfr1166 C T 2: 88,124,199 C262Y probably damaging Het
Olfr1270 T A 2: 90,149,278 T243S possibly damaging Het
Pcdhb7 A T 18: 37,343,361 I517F probably damaging Het
Plk2 C T 13: 110,397,762 A292V probably benign Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Rasgrf1 A T 9: 90,012,794 N1089I possibly damaging Het
Robo2 T A 16: 73,971,108 N603Y probably damaging Het
Slc35f4 G A 14: 49,525,600 A5V probably damaging Het
Smc4 A T 3: 69,025,893 I616F probably damaging Het
Sorl1 T G 9: 42,001,603 N1361H possibly damaging Het
Syngr1 C T 15: 80,111,692 T144M probably damaging Het
Tbx15 A G 3: 99,352,192 S460G probably benign Het
Tns2 G A 15: 102,110,559 R395Q probably benign Het
Tpte T C 8: 22,333,269 L304P probably damaging Het
Tubgcp5 T A 7: 55,806,634 F325I probably benign Het
Ucp3 A T 7: 100,481,933 I198F probably benign Het
Vit T C 17: 78,622,845 V413A probably benign Het
Xrcc6 T C 15: 82,022,954 M1T probably null Het
Other mutations in Tbc1d16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Tbc1d16 APN 11 119156075 missense possibly damaging 0.69
IGL01973:Tbc1d16 APN 11 119156707 missense probably benign 0.19
IGL02456:Tbc1d16 APN 11 119210546 missense probably damaging 1.00
H8441:Tbc1d16 UTSW 11 119149014 nonsense probably null
R0118:Tbc1d16 UTSW 11 119157816 missense probably damaging 1.00
R0255:Tbc1d16 UTSW 11 119147575 missense possibly damaging 0.94
R0330:Tbc1d16 UTSW 11 119158729 critical splice donor site probably null
R0620:Tbc1d16 UTSW 11 119209038 missense probably benign 0.04
R1502:Tbc1d16 UTSW 11 119154004 missense probably damaging 1.00
R1806:Tbc1d16 UTSW 11 119156101 missense probably damaging 1.00
R2163:Tbc1d16 UTSW 11 119155078 splice site probably benign
R2897:Tbc1d16 UTSW 11 119157828 missense probably damaging 0.97
R2898:Tbc1d16 UTSW 11 119157828 missense probably damaging 0.97
R4454:Tbc1d16 UTSW 11 119157873 missense possibly damaging 0.86
R5193:Tbc1d16 UTSW 11 119158820 missense probably benign 0.00
R5465:Tbc1d16 UTSW 11 119156059 missense probably benign
R5478:Tbc1d16 UTSW 11 119155091 missense probably benign 0.07
R5642:Tbc1d16 UTSW 11 119158791 missense probably damaging 0.98
R5721:Tbc1d16 UTSW 11 119158730 critical splice donor site probably null
R6195:Tbc1d16 UTSW 11 119210565 nonsense probably null
R6233:Tbc1d16 UTSW 11 119210565 nonsense probably null
R6932:Tbc1d16 UTSW 11 119208916 missense probably damaging 1.00
R7023:Tbc1d16 UTSW 11 119158791 missense probably damaging 0.98
R7262:Tbc1d16 UTSW 11 119155095 missense probably benign 0.00
R8006:Tbc1d16 UTSW 11 119156072 missense probably damaging 0.96
R8506:Tbc1d16 UTSW 11 119148958 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCAAATGCCATTCTCCTC -3'
(R):5'- CAGCGGGCTCTGATTAAACTC -3'

Sequencing Primer
(F):5'- AAATGCCATTCTCCTCAGAGGGG -3'
(R):5'- CGGGCTCTGATTAAACTCGGAAATC -3'
Posted On2018-06-22