Incidental Mutation 'R8839:Tbc1d16'
ID 674331
Institutional Source Beutler Lab
Gene Symbol Tbc1d16
Ensembl Gene ENSMUSG00000039976
Gene Name TBC1 domain family, member 16
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8839 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 119143045-119228499 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119156648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 417 (R417C)
Ref Sequence ENSEMBL: ENSMUSP00000048516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036113] [ENSMUST00000207655]
AlphaFold A2ABG4
Predicted Effect probably damaging
Transcript: ENSMUST00000036113
AA Change: R417C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048516
Gene: ENSMUSG00000039976
AA Change: R417C

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Blast:TBC 63 362 5e-75 BLAST
Blast:TBC 373 418 2e-13 BLAST
TBC 421 659 4.39e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207655
AA Change: R416C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,040 Y325H probably damaging Het
Ace3 T C 11: 105,998,368 Y475H probably damaging Het
Ankfy1 T C 11: 72,730,566 I226T probably benign Het
Anln G A 9: 22,356,172 S825L probably benign Het
B3galt4 A G 17: 33,950,893 S124P possibly damaging Het
Cabin1 T C 10: 75,656,816 I1882V probably benign Het
Caprin2 A T 6: 148,873,027 S262R probably benign Het
Csmd2 A C 4: 128,442,888 I1420L Het
Cyp2b9 T G 7: 26,200,760 V331G probably damaging Het
Cyp3a59 A T 5: 146,109,086 M433L probably benign Het
Edrf1 A G 7: 133,653,915 D597G probably benign Het
Emc3 G A 6: 113,519,970 R147C possibly damaging Het
Fam172a A T 13: 77,999,662 H283L probably benign Het
Fkbp7 T C 2: 76,667,237 probably benign Het
Flii T C 11: 60,718,607 T665A possibly damaging Het
Fxr1 A G 3: 34,046,682 probably benign Het
Gpr37 T G 6: 25,669,370 I492L probably benign Het
Hmg20b A C 10: 81,348,915 W108G probably damaging Het
Ighv9-3 G A 12: 114,140,765 T93I possibly damaging Het
Inpp5a T C 7: 139,389,433 V15A probably benign Het
Inpp5d T A 1: 87,691,711 Y376N probably damaging Het
Ints6 A G 14: 62,693,673 F854L probably benign Het
Ipo7 A T 7: 110,042,016 K314N probably damaging Het
Ltn1 C A 16: 87,418,502 C415F probably damaging Het
Mfsd9 T C 1: 40,774,394 T254A probably benign Het
Musk A G 4: 58,286,151 T14A probably benign Het
Ncapd3 T C 9: 27,094,434 V1438A Het
Nnt A T 13: 119,357,637 V636D unknown Het
Olfr1338 A G 4: 118,754,214 L110P probably damaging Het
Olfr629 A G 7: 103,740,814 I142T probably benign Het
Olfr748 A T 14: 50,710,500 T57S possibly damaging Het
Ost4 T C 5: 30,907,591 probably benign Het
Pdzph1 T C 17: 58,950,242 T934A probably benign Het
Plekhn1 T A 4: 156,222,589 probably benign Het
Prkd1 T C 12: 50,342,833 probably benign Het
Ptch1 A T 13: 63,541,224 L413Q probably damaging Het
S100pbp A G 4: 129,182,207 probably null Het
Sec23a T C 12: 58,990,995 K361E possibly damaging Het
Sema3b C T 9: 107,601,353 probably benign Het
Serpina3g A G 12: 104,237,779 probably benign Het
Slc23a2 C T 2: 132,101,472 silent Het
Smug1 T C 15: 103,155,820 R225G possibly damaging Het
Srbd1 T A 17: 85,988,421 I854L probably benign Het
Tiam1 A G 16: 89,884,939 Y384H probably damaging Het
Trappc9 T A 15: 73,058,238 K90* probably null Het
Tubgcp6 A T 15: 89,103,478 H1097Q possibly damaging Het
Ugt2b37 A G 5: 87,254,556 L72P probably damaging Het
Vmn2r20 A T 6: 123,396,556 H442Q possibly damaging Het
Vmn2r65 A T 7: 84,946,281 Y398* probably null Het
Zfhx4 A G 3: 5,401,855 T2383A probably benign Het
Other mutations in Tbc1d16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Tbc1d16 APN 11 119156075 missense possibly damaging 0.69
IGL01973:Tbc1d16 APN 11 119156707 missense probably benign 0.19
IGL02456:Tbc1d16 APN 11 119210546 missense probably damaging 1.00
H8441:Tbc1d16 UTSW 11 119149014 nonsense probably null
R0118:Tbc1d16 UTSW 11 119157816 missense probably damaging 1.00
R0255:Tbc1d16 UTSW 11 119147575 missense possibly damaging 0.94
R0330:Tbc1d16 UTSW 11 119158729 critical splice donor site probably null
R0620:Tbc1d16 UTSW 11 119209038 missense probably benign 0.04
R1502:Tbc1d16 UTSW 11 119154004 missense probably damaging 1.00
R1806:Tbc1d16 UTSW 11 119156101 missense probably damaging 1.00
R2163:Tbc1d16 UTSW 11 119155078 splice site probably benign
R2897:Tbc1d16 UTSW 11 119157828 missense probably damaging 0.97
R2898:Tbc1d16 UTSW 11 119157828 missense probably damaging 0.97
R4454:Tbc1d16 UTSW 11 119157873 missense possibly damaging 0.86
R5193:Tbc1d16 UTSW 11 119158820 missense probably benign 0.00
R5465:Tbc1d16 UTSW 11 119156059 missense probably benign
R5478:Tbc1d16 UTSW 11 119155091 missense probably benign 0.07
R5642:Tbc1d16 UTSW 11 119158791 missense probably damaging 0.98
R5721:Tbc1d16 UTSW 11 119158730 critical splice donor site probably null
R6195:Tbc1d16 UTSW 11 119210565 nonsense probably null
R6233:Tbc1d16 UTSW 11 119210565 nonsense probably null
R6596:Tbc1d16 UTSW 11 119157775 missense probably damaging 1.00
R6932:Tbc1d16 UTSW 11 119208916 missense probably damaging 1.00
R7023:Tbc1d16 UTSW 11 119158791 missense probably damaging 0.98
R7262:Tbc1d16 UTSW 11 119155095 missense probably benign 0.00
R8006:Tbc1d16 UTSW 11 119156072 missense probably damaging 0.96
R8506:Tbc1d16 UTSW 11 119148958 missense probably damaging 0.98
R8532:Tbc1d16 UTSW 11 119155167 missense probably benign 0.11
R8753:Tbc1d16 UTSW 11 119210666 missense probably damaging 1.00
R9049:Tbc1d16 UTSW 11 119209264 missense probably damaging 1.00
R9104:Tbc1d16 UTSW 11 119147800 missense probably damaging 1.00
R9378:Tbc1d16 UTSW 11 119208840 missense probably damaging 1.00
R9461:Tbc1d16 UTSW 11 119153955 missense probably damaging 1.00
R9498:Tbc1d16 UTSW 11 119157855 missense probably damaging 0.98
R9544:Tbc1d16 UTSW 11 119210509 missense probably damaging 1.00
R9588:Tbc1d16 UTSW 11 119210509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCCAAACTCTGCAATTGTC -3'
(R):5'- TGGCTTTGACATTCTGGGAAC -3'

Sequencing Primer
(F):5'- CTTTTCAATGAAGCTGCCTGG -3'
(R):5'- AACAGCGTCTCAGGCTTC -3'
Posted On 2021-07-15