Incidental Mutation 'R6675:Gad2'
ID527233
Institutional Source Beutler Lab
Gene Symbol Gad2
Ensembl Gene ENSMUSG00000026787
Gene Nameglutamic acid decarboxylase 2
SynonymsGad-2, 6330404F12Rik, GAD(65), GAD65
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6675 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location22622205-22693874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22673985 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 400 (V400A)
Ref Sequence ENSEMBL: ENSMUSP00000028123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028123]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028123
AA Change: V400A

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028123
Gene: ENSMUSG00000026787
AA Change: V400A

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 138 509 7.8e-138 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit spontaneous (frequently fatal) seizures, increased anxiety-like behavior, and reduced intermale aggression. Heterozygotes show reduced aggressiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,115,476 T1268A probably benign Het
Adamts20 A G 15: 94,331,316 probably null Het
Arhgap45 G T 10: 80,018,104 D151Y probably null Het
Arhgef40 C A 14: 51,991,641 L592I probably damaging Het
Ascc3 G T 10: 50,750,563 E1720* probably null Het
Atp2c1 C T 9: 105,453,533 probably null Het
Avpi1 G A 19: 42,123,744 P125L probably benign Het
Cers3 A T 7: 66,786,096 T232S possibly damaging Het
Cfap53 T C 18: 74,307,376 probably null Het
Col4a3 T C 1: 82,668,925 S386P unknown Het
Dhtkd1 A T 2: 5,904,078 M735K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm13103 G A 4: 143,853,258 C471Y probably damaging Het
Hmgxb3 T G 18: 61,137,576 D892A possibly damaging Het
Hsd3b2 G A 3: 98,713,472 T89I probably benign Het
Iars C A 13: 49,719,578 A713D probably damaging Het
Itih1 G A 14: 30,929,841 T848I possibly damaging Het
Kcne2 A G 16: 92,296,624 D13G probably benign Het
Klra17 T A 6: 129,872,323 N96I probably damaging Het
Lrig2 T C 3: 104,457,935 N634D probably benign Het
Mrc2 T A 11: 105,343,080 probably null Het
Mroh3 A T 1: 136,190,812 S558T possibly damaging Het
Ncapg2 G T 12: 116,434,661 K627N possibly damaging Het
Ncstn A T 1: 172,071,528 D345E probably damaging Het
Nkx1-1 G T 5: 33,433,879 A33E unknown Het
Olfr134 T A 17: 38,176,014 M310K probably benign Het
Olfr568 A G 7: 102,877,273 E51G possibly damaging Het
Osbpl9 G T 4: 109,133,828 probably null Het
P2rx6 T C 16: 17,562,168 V52A probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Pdk2 T C 11: 95,028,742 I273V probably benign Het
Pdpr C T 8: 111,101,900 Q12* probably null Het
Plxdc2 A G 2: 16,712,121 T339A probably benign Het
Retsat T C 6: 72,601,689 V128A probably benign Het
Rnf17 A G 14: 56,459,975 E442G probably damaging Het
Sec31b T C 19: 44,523,775 N560S probably benign Het
Slc22a16 C T 10: 40,573,840 Q91* probably null Het
Slc24a5 G T 2: 125,080,695 A126S possibly damaging Het
Slc26a4 A T 12: 31,540,513 D380E possibly damaging Het
Stc2 T A 11: 31,360,307 D243V probably benign Het
Tshz2 G T 2: 169,886,045 A385S probably damaging Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vmn1r77 A G 7: 12,041,455 T53A probably damaging Het
Zeb2 A T 2: 44,997,445 Y518* probably null Het
Zfp760 T A 17: 21,723,010 S389T possibly damaging Het
Other mutations in Gad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Gad2 APN 2 22685386 missense probably benign 0.07
IGL00870:Gad2 APN 2 22629971 missense probably benign 0.42
IGL01142:Gad2 APN 2 22681285 splice site probably benign
IGL01577:Gad2 APN 2 22681280 splice site probably benign
IGL01671:Gad2 APN 2 22623699 nonsense probably null
IGL02346:Gad2 APN 2 22629939 splice site probably benign
IGL02348:Gad2 APN 2 22629393 missense probably damaging 1.00
IGL03113:Gad2 APN 2 22681355 missense probably benign 0.09
gruene UTSW 2 22685067 critical splice donor site probably null
Mosey UTSW 2 22668257 missense probably damaging 1.00
R0630:Gad2 UTSW 2 22690336 missense probably benign 0.14
R1109:Gad2 UTSW 2 22681394 missense probably damaging 1.00
R1109:Gad2 UTSW 2 22690159 splice site probably benign
R1122:Gad2 UTSW 2 22623451 missense possibly damaging 0.68
R1604:Gad2 UTSW 2 22623840 critical splice donor site probably null
R1773:Gad2 UTSW 2 22690207 missense probably benign
R1895:Gad2 UTSW 2 22685428 missense probably benign
R1946:Gad2 UTSW 2 22685428 missense probably benign
R2329:Gad2 UTSW 2 22668289 missense probably damaging 1.00
R2857:Gad2 UTSW 2 22673975 missense probably benign 0.02
R3754:Gad2 UTSW 2 22681340 missense possibly damaging 0.91
R3847:Gad2 UTSW 2 22684988 missense probably benign 0.00
R4382:Gad2 UTSW 2 22685410 missense probably benign
R4383:Gad2 UTSW 2 22685410 missense probably benign
R4384:Gad2 UTSW 2 22685410 missense probably benign
R4651:Gad2 UTSW 2 22668362 missense probably damaging 1.00
R4700:Gad2 UTSW 2 22673970 missense probably damaging 1.00
R4766:Gad2 UTSW 2 22622667 missense probably damaging 0.99
R5279:Gad2 UTSW 2 22673957 missense probably benign 0.38
R5372:Gad2 UTSW 2 22690243 missense possibly damaging 0.84
R5505:Gad2 UTSW 2 22624833 missense probably benign
R5820:Gad2 UTSW 2 22690249 missense probably benign 0.00
R5868:Gad2 UTSW 2 22685067 critical splice donor site probably null
R6026:Gad2 UTSW 2 22623736 missense probably benign 0.00
R6497:Gad2 UTSW 2 22668257 missense probably damaging 1.00
R7157:Gad2 UTSW 2 22635023 missense probably damaging 0.98
R7352:Gad2 UTSW 2 22623823 missense probably benign 0.00
R7951:Gad2 UTSW 2 22623487 missense probably damaging 0.96
R8285:Gad2 UTSW 2 22624928 missense probably benign 0.45
X0019:Gad2 UTSW 2 22690172 critical splice acceptor site probably null
Z1177:Gad2 UTSW 2 22635014 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCCTCCCTGTGAACAATGG -3'
(R):5'- ACATGCAGATGAAGTCAAGGTCTC -3'

Sequencing Primer
(F):5'- CCTCCCTGTGAACAATGGAAGATG -3'
(R):5'- CAAGGTCTCAGTTCTGAAGGC -3'
Posted On2018-07-23