Incidental Mutation 'R6811:Pdx1'
ID533799
Institutional Source Beutler Lab
Gene Symbol Pdx1
Ensembl Gene ENSMUSG00000029644
Gene Namepancreatic and duodenal homeobox 1
SynonymsIDX-1, Ipf1, IPF-1, Mody4, pdx-1, STF-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6811 (G1)
Quality Score152.008
Status Not validated
Chromosome5
Chromosomal Location147269959-147275848 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 147274664 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 232 (S232P)
Ref Sequence ENSEMBL: ENSMUSP00000082729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085591]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085591
AA Change: S232P

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082729
Gene: ENSMUSG00000029644
AA Change: S232P

DomainStartEndE-ValueType
low complexity region 78 109 N/A INTRINSIC
HOX 147 209 4.67e-27 SMART
low complexity region 211 225 N/A INTRINSIC
low complexity region 236 257 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator of several genes, including insulin, somatostatin, glucokinase, islet amyloid polypeptide, and glucose transporter type 2. The encoded nuclear protein is involved in the early development of the pancreas and plays a major role in glucose-dependent regulation of insulin gene expression. Defects in this gene are a cause of pancreatic agenesis, which can lead to early-onset insulin-dependent diabetes mellitus (NIDDM), as well as maturity onset diabetes of the young type 4 (MODY4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal pancreatic and liver development, and increased plasma glucose levels. Mice heterozygous for a knock-out allele exhibit abnormal pancreatic development and abnormal glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,529,361 S69P probably damaging Het
Alkbh7 G T 17: 56,997,392 R10L probably benign Het
Ano3 T C 2: 110,880,867 E84G probably benign Het
Asxl3 A G 18: 22,522,911 E1326G possibly damaging Het
Atrnl1 T G 19: 57,654,961 M427R probably damaging Het
Cenpf T C 1: 189,654,542 E1847G probably benign Het
Csf1r T C 18: 61,119,053 Y536H probably damaging Het
Dnm3 T C 1: 162,321,083 K240E probably damaging Het
Dsc1 T G 18: 20,089,654 E587A probably benign Het
Gm16486 T C 8: 70,716,773 S1171P probably benign Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm19965 G T 1: 116,804,079 L38F probably damaging Het
Helz T C 11: 107,619,318 probably null Het
Herc2 C T 7: 56,113,433 R929* probably null Het
Krt31 A G 11: 100,048,416 L225P probably damaging Het
Lrp1b T C 2: 40,715,500 probably null Het
Lrp1b A G 2: 41,449,194 V765A probably benign Het
Lsm5 A G 6: 56,702,142 I34T possibly damaging Het
Ly6g6c T C 17: 35,069,410 L86P probably damaging Het
Megf11 A G 9: 64,544,641 T116A probably damaging Het
Megf6 T C 4: 154,252,161 C190R probably damaging Het
Mroh9 A G 1: 163,046,041 V515A possibly damaging Het
Mtbp C A 15: 55,606,546 probably null Het
Myo9b T A 8: 71,356,578 F1810L probably damaging Het
Nacad T G 11: 6,599,400 K180Q possibly damaging Het
Ncf2 G A 1: 152,836,040 V502I probably benign Het
Npsr1 T A 9: 24,134,809 C75S probably benign Het
Oog3 T C 4: 144,159,582 T149A probably benign Het
Pank1 T A 19: 34,841,022 Q39L probably benign Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pirb A T 7: 3,719,642 V117E possibly damaging Het
Ppl G A 16: 5,089,144 L1096F probably damaging Het
Rev3l T A 10: 39,830,921 Y2223* probably null Het
Slc16a4 A G 3: 107,298,917 Y101C probably benign Het
Slc17a3 A T 13: 23,855,941 I321F possibly damaging Het
Sufu T A 19: 46,449,878 D168E probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tldc1 A T 8: 119,768,290 I243N possibly damaging Het
Vmn1r237 T G 17: 21,314,386 S124A probably benign Het
Vmn2r60 T A 7: 42,194,886 C558S probably damaging Het
Vwa5b1 G A 4: 138,592,103 T414I probably benign Het
Zfp651 T C 9: 121,766,529 S573P probably damaging Het
Zfp971 T G 2: 178,033,881 C424W possibly damaging Het
Other mutations in Pdx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01724:Pdx1 APN 5 147274407 missense probably damaging 0.99
IGL02729:Pdx1 APN 5 147274614 missense probably benign 0.21
R6500:Pdx1 UTSW 5 147270630 missense probably damaging 0.99
R6722:Pdx1 UTSW 5 147270500 missense probably damaging 1.00
R8253:Pdx1 UTSW 5 147270649 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TATTTAACAAATACATCTCCCGGCC -3'
(R):5'- TCTTCTTGTGCGACGCCTAG -3'

Sequencing Primer
(F):5'- CAAAACCGTCGCATGAAG -3'
(R):5'- TGCGACGCCTAGGTTAAGTTCC -3'
Posted On2018-09-12