Incidental Mutation 'R6851:Olfr339'
ID534956
Institutional Source Beutler Lab
Gene Symbol Olfr339
Ensembl Gene ENSMUSG00000094464
Gene Nameolfactory receptor 339
SynonymsMOR136-3, GA_x6K02T2NLDC-33116096-33117025
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6851 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location36418947-36426123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36421820 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 141 (C141S)
Ref Sequence ENSEMBL: ENSMUSP00000149068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071437] [ENSMUST00000216645]
Predicted Effect probably damaging
Transcript: ENSMUST00000071437
AA Change: C141S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071383
Gene: ENSMUSG00000094464
AA Change: C141S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.9e-55 PFAM
Pfam:7tm_1 41 290 5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216645
AA Change: C141S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,312,419 C856S probably benign Het
Arrdc2 T C 8: 70,838,725 E153G probably damaging Het
BC051142 A T 17: 34,460,172 Y303F possibly damaging Het
BC055324 G A 1: 163,964,767 R554C probably damaging Het
Cacna1d T C 14: 30,042,782 D2033G probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cracr2a A T 6: 127,608,716 D159V probably damaging Het
Defa35 T C 8: 21,065,130 I22T possibly damaging Het
Dgke T C 11: 89,052,483 T227A probably benign Het
Galnt10 G A 11: 57,765,632 R214Q probably damaging Het
Gm11639 G A 11: 105,005,695 R4290K probably benign Het
Gpr180 T C 14: 118,153,625 Y189H probably damaging Het
Hadh A G 3: 131,271,971 S13P possibly damaging Het
Hcn2 T A 10: 79,729,113 probably null Het
Irgm2 T C 11: 58,219,815 S123P possibly damaging Het
Kcnv1 T A 15: 45,109,198 I430F probably damaging Het
Kif13b G A 14: 64,773,065 C1271Y probably damaging Het
Klhdc3 A T 17: 46,678,292 I48N possibly damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Mprip T A 11: 59,759,015 W1182R probably damaging Het
Mycbp2 A T 14: 103,260,194 probably null Het
Olfr1099 T C 2: 86,959,267 T64A possibly damaging Het
Olfr1112 T A 2: 87,192,469 S261T probably benign Het
Olfr1160 T A 2: 88,005,956 H265L probably damaging Het
Olfr916 A G 9: 38,658,185 V69A probably benign Het
Osbpl8 T A 10: 111,270,618 Y295* probably null Het
Pex5 A G 6: 124,403,154 S275P possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Sele G T 1: 164,053,952 G543C probably damaging Het
Serpina3k A C 12: 104,345,366 Y401S probably benign Het
Slc13a4 A G 6: 35,301,733 S74P probably damaging Het
Spata31d1a A G 13: 59,703,911 L114P unknown Het
Syne1 G T 10: 5,262,703 C3295* probably null Het
Tepsin G T 11: 120,096,961 H44N probably damaging Het
Tpp1 A T 7: 105,749,712 V170E probably damaging Het
Trav3-1 T C 14: 52,580,971 V34A probably damaging Het
Ush2a T C 1: 188,533,205 V1642A probably benign Het
Vmn1r122 A G 7: 21,133,920 I70T probably benign Het
Vmn2r96 A G 17: 18,582,538 M237V possibly damaging Het
Wdr75 A G 1: 45,823,427 E802G probably benign Het
Zan G A 5: 137,396,191 T4462I unknown Het
Other mutations in Olfr339
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Olfr339 APN 2 36421704 missense probably benign 0.44
IGL01447:Olfr339 APN 2 36421454 missense probably damaging 0.97
IGL01845:Olfr339 APN 2 36422093 missense probably benign 0.27
IGL02728:Olfr339 APN 2 36422144 missense possibly damaging 0.95
IGL02941:Olfr339 APN 2 36422120 missense probably damaging 1.00
R0128:Olfr339 UTSW 2 36422287 missense probably benign 0.16
R0130:Olfr339 UTSW 2 36422287 missense probably benign 0.16
R1432:Olfr339 UTSW 2 36421643 missense probably damaging 1.00
R1451:Olfr339 UTSW 2 36421865 missense probably benign 0.01
R1656:Olfr339 UTSW 2 36421646 missense probably benign 0.00
R1854:Olfr339 UTSW 2 36421874 missense probably damaging 0.97
R2012:Olfr339 UTSW 2 36421919 missense probably benign 0.00
R2093:Olfr339 UTSW 2 36421929 missense probably benign 0.00
R2136:Olfr339 UTSW 2 36421938 missense probably damaging 1.00
R2282:Olfr339 UTSW 2 36422000 missense probably benign 0.00
R4363:Olfr339 UTSW 2 36421532 missense probably damaging 1.00
R4466:Olfr339 UTSW 2 36422296 missense probably benign 0.00
R4628:Olfr339 UTSW 2 36421857 nonsense probably null
R4839:Olfr339 UTSW 2 36422000 missense probably benign 0.00
R6023:Olfr339 UTSW 2 36421511 missense probably damaging 0.98
R6305:Olfr339 UTSW 2 36421622 missense probably damaging 1.00
R6486:Olfr339 UTSW 2 36421544 missense probably damaging 1.00
R6864:Olfr339 UTSW 2 36421820 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGCTCCTAAGATGCTCGTG -3'
(R):5'- TGAATGGCAGGGTAATGACC -3'

Sequencing Primer
(F):5'- GCTCCTAAGATGCTCGTGAATATGC -3'
(R):5'- ACAAAGATGACCAGCTCATTGATG -3'
Posted On2018-09-12