Incidental Mutation 'R6851:Vmn2r96'
ID534988
Institutional Source Beutler Lab
Gene Symbol Vmn2r96
Ensembl Gene ENSMUSG00000091679
Gene Namevomeronasal 2, receptor 96
SynonymsEG433070
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R6851 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location18573151-18616003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18582538 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 237 (M237V)
Ref Sequence ENSEMBL: ENSMUSP00000156012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165692] [ENSMUST00000177244] [ENSMUST00000231261] [ENSMUST00000231286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165692
AA Change: M45V

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131564
Gene: ENSMUSG00000091679
AA Change: M45V

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 257 8.6e-20 PFAM
Pfam:NCD3G 317 370 3.7e-22 PFAM
Pfam:7tm_3 402 638 3.9e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177244
AA Change: M237V

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135095
Gene: ENSMUSG00000091679
AA Change: M237V

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 245 4.2e-19 PFAM
Pfam:NCD3G 317 370 6.9e-21 PFAM
Pfam:7tm_3 400 639 3.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231261
Predicted Effect possibly damaging
Transcript: ENSMUST00000231286
AA Change: M237V

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,312,419 C856S probably benign Het
Arrdc2 T C 8: 70,838,725 E153G probably damaging Het
BC051142 A T 17: 34,460,172 Y303F possibly damaging Het
BC055324 G A 1: 163,964,767 R554C probably damaging Het
Cacna1d T C 14: 30,042,782 D2033G probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cracr2a A T 6: 127,608,716 D159V probably damaging Het
Defa35 T C 8: 21,065,130 I22T possibly damaging Het
Dgke T C 11: 89,052,483 T227A probably benign Het
Galnt10 G A 11: 57,765,632 R214Q probably damaging Het
Gm11639 G A 11: 105,005,695 R4290K probably benign Het
Gpr180 T C 14: 118,153,625 Y189H probably damaging Het
Hadh A G 3: 131,271,971 S13P possibly damaging Het
Hcn2 T A 10: 79,729,113 probably null Het
Irgm2 T C 11: 58,219,815 S123P possibly damaging Het
Kcnv1 T A 15: 45,109,198 I430F probably damaging Het
Kif13b G A 14: 64,773,065 C1271Y probably damaging Het
Klhdc3 A T 17: 46,678,292 I48N possibly damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Mprip T A 11: 59,759,015 W1182R probably damaging Het
Mycbp2 A T 14: 103,260,194 probably null Het
Olfr1099 T C 2: 86,959,267 T64A possibly damaging Het
Olfr1112 T A 2: 87,192,469 S261T probably benign Het
Olfr1160 T A 2: 88,005,956 H265L probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Olfr916 A G 9: 38,658,185 V69A probably benign Het
Osbpl8 T A 10: 111,270,618 Y295* probably null Het
Pex5 A G 6: 124,403,154 S275P possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Sele G T 1: 164,053,952 G543C probably damaging Het
Serpina3k A C 12: 104,345,366 Y401S probably benign Het
Slc13a4 A G 6: 35,301,733 S74P probably damaging Het
Spata31d1a A G 13: 59,703,911 L114P unknown Het
Syne1 G T 10: 5,262,703 C3295* probably null Het
Tepsin G T 11: 120,096,961 H44N probably damaging Het
Tpp1 A T 7: 105,749,712 V170E probably damaging Het
Trav3-1 T C 14: 52,580,971 V34A probably damaging Het
Ush2a T C 1: 188,533,205 V1642A probably benign Het
Vmn1r122 A G 7: 21,133,920 I70T probably benign Het
Wdr75 A G 1: 45,823,427 E802G probably benign Het
Zan G A 5: 137,396,191 T4462I unknown Het
Other mutations in Vmn2r96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00563:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00769:Vmn2r96 APN 17 18583819 missense probably benign 0.00
IGL01314:Vmn2r96 APN 17 18582964 missense probably benign 0.00
IGL01983:Vmn2r96 APN 17 18597265 missense probably damaging 0.99
IGL02314:Vmn2r96 APN 17 18583959 missense probably benign 0.01
IGL02600:Vmn2r96 APN 17 18597567 missense probably benign
IGL02672:Vmn2r96 APN 17 18598114 missense probably benign 0.02
IGL02750:Vmn2r96 APN 17 18582589 missense probably benign 0.01
IGL03068:Vmn2r96 APN 17 18582875 missense probably benign 0.00
IGL03411:Vmn2r96 APN 17 18586372 missense possibly damaging 0.88
R0316:Vmn2r96 UTSW 17 18582565 missense probably damaging 1.00
R0502:Vmn2r96 UTSW 17 18584000 missense probably benign
R0580:Vmn2r96 UTSW 17 18582638 missense probably damaging 1.00
R0652:Vmn2r96 UTSW 17 18597568 missense probably benign 0.05
R0789:Vmn2r96 UTSW 17 18582476 missense possibly damaging 0.81
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1660:Vmn2r96 UTSW 17 18597726 missense probably benign 0.00
R1755:Vmn2r96 UTSW 17 18582653 missense possibly damaging 0.50
R1843:Vmn2r96 UTSW 17 18597921 missense probably benign 0.14
R1943:Vmn2r96 UTSW 17 18586402 missense probably benign 0.09
R1993:Vmn2r96 UTSW 17 18583876 missense probably damaging 1.00
R2018:Vmn2r96 UTSW 17 18584001 missense probably benign
R2405:Vmn2r96 UTSW 17 18597840 missense probably damaging 0.96
R3977:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R3979:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R4059:Vmn2r96 UTSW 17 18598077 missense probably benign 0.20
R4693:Vmn2r96 UTSW 17 18583008 missense probably benign 0.03
R4709:Vmn2r96 UTSW 17 18582826 missense probably benign 0.36
R4776:Vmn2r96 UTSW 17 18597508 missense probably damaging 1.00
R4882:Vmn2r96 UTSW 17 18597604 missense probably damaging 1.00
R4920:Vmn2r96 UTSW 17 18582656 missense probably benign 0.07
R5143:Vmn2r96 UTSW 17 18583858 missense possibly damaging 0.65
R5301:Vmn2r96 UTSW 17 18597688 missense probably damaging 0.98
R5507:Vmn2r96 UTSW 17 18597829 missense probably damaging 1.00
R6151:Vmn2r96 UTSW 17 18583959 missense probably benign 0.01
R6181:Vmn2r96 UTSW 17 18583864 missense probably benign
R6339:Vmn2r96 UTSW 17 18583862 missense possibly damaging 0.84
R6404:Vmn2r96 UTSW 17 18597531 missense probably damaging 1.00
R6452:Vmn2r96 UTSW 17 18583855 missense probably benign 0.07
R6749:Vmn2r96 UTSW 17 18598090 missense probably damaging 0.99
R6813:Vmn2r96 UTSW 17 18581854 missense probably benign 0.04
R6944:Vmn2r96 UTSW 17 18597629 missense probably benign 0.16
R6949:Vmn2r96 UTSW 17 18597838 missense probably damaging 1.00
R6962:Vmn2r96 UTSW 17 18598021 missense probably damaging 0.99
R6990:Vmn2r96 UTSW 17 18583820 missense probably benign
R7149:Vmn2r96 UTSW 17 18597727 missense possibly damaging 0.89
R7346:Vmn2r96 UTSW 17 18582767 missense probably benign 0.15
R7385:Vmn2r96 UTSW 17 18583040 missense probably damaging 1.00
R7442:Vmn2r96 UTSW 17 18573400 missense probably benign 0.02
R7509:Vmn2r96 UTSW 17 18582733 missense probably benign 0.02
Z1088:Vmn2r96 UTSW 17 18597366 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCTCCTGAGTGACCATGGTC -3'
(R):5'- AGGCTCCCATGGAATGAGTC -3'

Sequencing Primer
(F):5'- GACCATGGTCAGTATCCTTCTC -3'
(R):5'- GCTCCCATGGAATGAGTCTAACATG -3'
Posted On2018-09-12