Incidental Mutation 'R6891:Foxred2'
ID537241
Institutional Source Beutler Lab
Gene Symbol Foxred2
Ensembl Gene ENSMUSG00000016552
Gene NameFAD-dependent oxidoreductase domain containing 2
SynonymsD15Bwg0759e, A430097D04Rik, LOC239554
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6891 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location77940522-77956722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77955709 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 127 (L127Q)
Ref Sequence ENSEMBL: ENSMUSP00000113403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016696] [ENSMUST00000100484] [ENSMUST00000117725]
Predicted Effect probably damaging
Transcript: ENSMUST00000016696
AA Change: L127Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016696
Gene: ENSMUSG00000016552
AA Change: L127Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 22 243 2.9e-11 PFAM
Pfam:Pyr_redox_3 25 240 9.3e-35 PFAM
Pfam:NAD_binding_8 26 84 3.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100484
SMART Domains Protein: ENSMUSP00000098053
Gene: ENSMUSG00000016554

DomainStartEndE-ValueType
Pfam:eIF-3_zeta 4 521 6.3e-220 PFAM
low complexity region 530 547 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117725
AA Change: L127Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113403
Gene: ENSMUSG00000016552
AA Change: L127Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 23 478 3.4e-9 PFAM
Pfam:Pyr_redox_3 25 240 6.2e-37 PFAM
Pfam:NAD_binding_8 26 90 4.8e-7 PFAM
Meta Mutation Damage Score 0.8320 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C A 2: 85,488,805 M384I possibly damaging Het
4833423E24Rik T G 2: 85,488,813 T382P probably damaging Het
Actl11 C T 9: 107,929,147 A223V probably benign Het
Agbl5 G T 5: 30,895,178 R61L probably damaging Het
Agmat A T 4: 141,755,881 T209S probably benign Het
Ankrd34a G A 3: 96,598,019 V180I probably benign Het
Anks1 C T 17: 28,057,424 T1047M probably damaging Het
Arhgap21 T A 2: 20,850,331 I1407F probably damaging Het
Armc1 C A 3: 19,135,041 C183F probably damaging Het
Atg13 A G 2: 91,685,791 M196T probably benign Het
AU040320 G T 4: 126,846,438 S864I possibly damaging Het
Btn2a2 T C 13: 23,482,844 D197G probably benign Het
Carmil1 A G 13: 24,141,723 I208T probably benign Het
Cbs T A 17: 31,622,457 R263S probably damaging Het
Ccdc7a C A 8: 129,026,638 R204L probably damaging Het
Cdhr1 A T 14: 37,097,377 probably null Het
Cers4 G A 8: 4,523,731 R378Q probably damaging Het
Chst1 T G 2: 92,613,743 L187V probably benign Het
Clec4e A T 6: 123,283,606 N164K probably damaging Het
Cln3 T A 7: 126,582,803 D29V possibly damaging Het
Crybg2 A G 4: 134,081,837 S187G probably benign Het
Ddx1 A T 12: 13,236,095 N285K probably benign Het
Dmxl2 A G 9: 54,480,380 I58T probably damaging Het
Dock4 A G 12: 40,779,136 Y1007C probably damaging Het
Eral1 C T 11: 78,075,733 V234I possibly damaging Het
Fam161b A G 12: 84,354,780 F400S probably damaging Het
Fmnl3 T C 15: 99,325,873 D314G probably damaging Het
Gjd2 G A 2: 114,013,094 A14V possibly damaging Het
Gm3106 C A 5: 94,218,119 P32Q probably damaging Het
Gon4l A G 3: 88,858,866 probably null Het
Gpr151 T A 18: 42,578,920 D231V probably benign Het
Gzf1 A T 2: 148,684,769 K387* probably null Het
Hfm1 T A 5: 106,917,374 K146N possibly damaging Het
Hgf G A 5: 16,604,922 probably null Het
Isoc2b A G 7: 4,851,488 S15P probably damaging Het
Itga5 A G 15: 103,357,543 S126P probably damaging Het
Kat6b A G 14: 21,669,036 D1152G probably benign Het
Kcna4 C T 2: 107,296,307 S462F probably damaging Het
Kif24 A T 4: 41,394,168 C902S probably benign Het
Lama2 A T 10: 27,328,072 C523* probably null Het
Lama2 G C 10: 27,328,082 S520* probably null Het
Ltf T C 9: 111,025,113 V332A probably benign Het
Mapkap1 T C 2: 34,563,141 F349L probably damaging Het
Mdm1 A G 10: 118,148,032 N188D probably benign Het
Mfn1 T C 3: 32,577,103 S730P possibly damaging Het
Mrgprd T A 7: 145,322,350 D319E probably benign Het
Mrps9 C A 1: 42,905,413 L364I probably damaging Het
Myo1h C T 5: 114,349,612 R626C probably damaging Het
Nme3 T C 17: 24,896,855 S61P probably benign Het
Olfr123 A G 17: 37,795,504 Q20R probably benign Het
Olfr670 A G 7: 104,959,985 I249T probably damaging Het
Pald1 A G 10: 61,348,532 probably null Het
Papola A T 12: 105,809,691 probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Plch1 T C 3: 63,698,083 T1458A probably benign Het
Polr3e A G 7: 120,944,650 Q659R probably damaging Het
Shoc2 T C 19: 53,988,117 V146A probably benign Het
Slc15a1 T C 14: 121,476,030 T362A probably benign Het
Smpd3 A G 8: 106,264,668 Y418H probably damaging Het
Sorcs1 A T 19: 50,225,119 C723* probably null Het
Supt7l T A 5: 31,523,021 N16Y probably damaging Het
Syngr2 T C 11: 117,812,673 V105A probably damaging Het
Thrb T A 14: 17,981,899 V8E probably benign Het
Tlx1 A T 19: 45,151,318 I135F probably damaging Het
Tnfaip3 A G 10: 19,011,669 I36T probably damaging Het
Troap A G 15: 99,082,688 Y583C possibly damaging Het
Usp17lb T C 7: 104,841,100 K207E probably benign Het
Vmn2r10 C T 5: 109,001,979 V400M probably damaging Het
Wdr49 A T 3: 75,333,283 probably null Het
Wdr64 G T 1: 175,706,068 W90L probably damaging Het
Yme1l1 A G 2: 23,195,389 E662G probably damaging Het
Zfp334 C T 2: 165,382,724 V68I probably benign Het
Other mutations in Foxred2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Foxred2 APN 15 77955620 missense probably benign 0.30
IGL01479:Foxred2 APN 15 77952289 splice site probably null
IGL01748:Foxred2 APN 15 77952346 missense probably damaging 1.00
IGL02160:Foxred2 APN 15 77955650 missense probably benign 0.03
IGL02328:Foxred2 APN 15 77955832 missense probably damaging 1.00
IGL02630:Foxred2 APN 15 77947162 missense probably benign 0.05
IGL02672:Foxred2 APN 15 77945577 critical splice donor site probably null
soma UTSW 15 77953358 missense possibly damaging 0.78
R0271:Foxred2 UTSW 15 77943390 missense possibly damaging 0.68
R1386:Foxred2 UTSW 15 77948521 critical splice acceptor site probably null
R1581:Foxred2 UTSW 15 77955761 missense possibly damaging 0.94
R4399:Foxred2 UTSW 15 77953358 missense possibly damaging 0.78
R4399:Foxred2 UTSW 15 77955680 missense probably benign 0.06
R4528:Foxred2 UTSW 15 77943249 missense probably benign 0.01
R4937:Foxred2 UTSW 15 77955835 missense probably damaging 1.00
R5165:Foxred2 UTSW 15 77956012 missense probably damaging 1.00
R5318:Foxred2 UTSW 15 77952398 missense probably benign 0.00
R5893:Foxred2 UTSW 15 77947144 missense probably damaging 1.00
R6336:Foxred2 UTSW 15 77955764 missense probably damaging 0.99
R6370:Foxred2 UTSW 15 77943306 missense probably benign 0.01
R6426:Foxred2 UTSW 15 77953308 missense probably damaging 1.00
R6826:Foxred2 UTSW 15 77947085 missense probably benign 0.01
R6934:Foxred2 UTSW 15 77952330 nonsense probably null
R7193:Foxred2 UTSW 15 77952030 missense probably damaging 1.00
Z1088:Foxred2 UTSW 15 77952003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCTTTGTAAGGACGCAC -3'
(R):5'- TCATCAGCATCAACAAGCGG -3'

Sequencing Primer
(F):5'- AAAGTTTTGCTTGGCACTGAACCC -3'
(R):5'- TCAACAAGCGGCACACGG -3'
Posted On2018-10-18