Incidental Mutation 'R6891:Anks1'
ID537246
Institutional Source Beutler Lab
Gene Symbol Anks1
Ensembl Gene ENSMUSG00000024219
Gene Nameankyrin repeat and SAM domain containing 1
SynonymsOdin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6891 (G1)
Quality Score216.009
Status Validated
Chromosome17
Chromosomal Location27909340-28062600 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28057424 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1047 (T1047M)
Ref Sequence ENSEMBL: ENSMUSP00000110491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025058] [ENSMUST00000088027] [ENSMUST00000114842]
Predicted Effect probably damaging
Transcript: ENSMUST00000025058
AA Change: T1047M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025058
Gene: ENSMUSG00000024219
AA Change: T1047M

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
low complexity region 1126 1135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088027
AA Change: T1026M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085344
Gene: ENSMUSG00000024219
AA Change: T1026M

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 144 173 1.88e-5 SMART
ANK 177 206 1.93e-2 SMART
ANK 210 239 1.64e-5 SMART
ANK 242 271 7.71e-2 SMART
low complexity region 398 418 N/A INTRINSIC
low complexity region 612 626 N/A INTRINSIC
SAM 688 757 3.2e-16 SMART
SAM 762 830 4.33e-13 SMART
Blast:PTB 840 898 2e-22 BLAST
PTB 932 1066 3.17e-43 SMART
low complexity region 1105 1114 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114842
AA Change: T1047M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110491
Gene: ENSMUSG00000024219
AA Change: T1047M

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (72/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C A 2: 85,488,805 M384I possibly damaging Het
4833423E24Rik T G 2: 85,488,813 T382P probably damaging Het
Actl11 C T 9: 107,929,147 A223V probably benign Het
Agbl5 G T 5: 30,895,178 R61L probably damaging Het
Agmat A T 4: 141,755,881 T209S probably benign Het
Ankrd34a G A 3: 96,598,019 V180I probably benign Het
Arhgap21 T A 2: 20,850,331 I1407F probably damaging Het
Armc1 C A 3: 19,135,041 C183F probably damaging Het
Atg13 A G 2: 91,685,791 M196T probably benign Het
AU040320 G T 4: 126,846,438 S864I possibly damaging Het
Btn2a2 T C 13: 23,482,844 D197G probably benign Het
Carmil1 A G 13: 24,141,723 I208T probably benign Het
Cbs T A 17: 31,622,457 R263S probably damaging Het
Ccdc7a C A 8: 129,026,638 R204L probably damaging Het
Cdhr1 A T 14: 37,097,377 probably null Het
Cers4 G A 8: 4,523,731 R378Q probably damaging Het
Chst1 T G 2: 92,613,743 L187V probably benign Het
Clec4e A T 6: 123,283,606 N164K probably damaging Het
Cln3 T A 7: 126,582,803 D29V possibly damaging Het
Crybg2 A G 4: 134,081,837 S187G probably benign Het
Ddx1 A T 12: 13,236,095 N285K probably benign Het
Dmxl2 A G 9: 54,480,380 I58T probably damaging Het
Dock4 A G 12: 40,779,136 Y1007C probably damaging Het
Eral1 C T 11: 78,075,733 V234I possibly damaging Het
Fam161b A G 12: 84,354,780 F400S probably damaging Het
Fmnl3 T C 15: 99,325,873 D314G probably damaging Het
Foxred2 A T 15: 77,955,709 L127Q probably damaging Het
Gjd2 G A 2: 114,013,094 A14V possibly damaging Het
Gm3106 C A 5: 94,218,119 P32Q probably damaging Het
Gon4l A G 3: 88,858,866 probably null Het
Gpr151 T A 18: 42,578,920 D231V probably benign Het
Gzf1 A T 2: 148,684,769 K387* probably null Het
Hfm1 T A 5: 106,917,374 K146N possibly damaging Het
Hgf G A 5: 16,604,922 probably null Het
Isoc2b A G 7: 4,851,488 S15P probably damaging Het
Itga5 A G 15: 103,357,543 S126P probably damaging Het
Kat6b A G 14: 21,669,036 D1152G probably benign Het
Kcna4 C T 2: 107,296,307 S462F probably damaging Het
Kif24 A T 4: 41,394,168 C902S probably benign Het
Lama2 A T 10: 27,328,072 C523* probably null Het
Lama2 G C 10: 27,328,082 S520* probably null Het
Ltf T C 9: 111,025,113 V332A probably benign Het
Mapkap1 T C 2: 34,563,141 F349L probably damaging Het
Mdm1 A G 10: 118,148,032 N188D probably benign Het
Mfn1 T C 3: 32,577,103 S730P possibly damaging Het
Mrgprd T A 7: 145,322,350 D319E probably benign Het
Mrps9 C A 1: 42,905,413 L364I probably damaging Het
Myo1h C T 5: 114,349,612 R626C probably damaging Het
Nme3 T C 17: 24,896,855 S61P probably benign Het
Olfr123 A G 17: 37,795,504 Q20R probably benign Het
Olfr670 A G 7: 104,959,985 I249T probably damaging Het
Pald1 A G 10: 61,348,532 probably null Het
Papola A T 12: 105,809,691 probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Plch1 T C 3: 63,698,083 T1458A probably benign Het
Polr3e A G 7: 120,944,650 Q659R probably damaging Het
Shoc2 T C 19: 53,988,117 V146A probably benign Het
Slc15a1 T C 14: 121,476,030 T362A probably benign Het
Smpd3 A G 8: 106,264,668 Y418H probably damaging Het
Sorcs1 A T 19: 50,225,119 C723* probably null Het
Supt7l T A 5: 31,523,021 N16Y probably damaging Het
Syngr2 T C 11: 117,812,673 V105A probably damaging Het
Thrb T A 14: 17,981,899 V8E probably benign Het
Tlx1 A T 19: 45,151,318 I135F probably damaging Het
Tnfaip3 A G 10: 19,011,669 I36T probably damaging Het
Troap A G 15: 99,082,688 Y583C possibly damaging Het
Usp17lb T C 7: 104,841,100 K207E probably benign Het
Vmn2r10 C T 5: 109,001,979 V400M probably damaging Het
Wdr49 A T 3: 75,333,283 probably null Het
Wdr64 G T 1: 175,706,068 W90L probably damaging Het
Yme1l1 A G 2: 23,195,389 E662G probably damaging Het
Zfp334 C T 2: 165,382,724 V68I probably benign Het
Other mutations in Anks1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Anks1 APN 17 28058416 missense possibly damaging 0.94
IGL00816:Anks1 APN 17 28059393 critical splice donor site probably null
IGL00940:Anks1 APN 17 28057354 missense probably damaging 1.00
IGL01306:Anks1 APN 17 27986253 missense probably damaging 1.00
IGL01485:Anks1 APN 17 28051584 missense probably damaging 1.00
IGL02059:Anks1 APN 17 28008046 missense possibly damaging 0.64
IGL02220:Anks1 APN 17 28054707 missense probably damaging 0.98
IGL02955:Anks1 APN 17 28054317 missense probably damaging 1.00
IGL03071:Anks1 APN 17 28008199 missense probably benign 0.37
ANU23:Anks1 UTSW 17 27986253 missense probably damaging 1.00
R0389:Anks1 UTSW 17 27995952 missense possibly damaging 0.68
R1221:Anks1 UTSW 17 28050642 missense possibly damaging 0.62
R1523:Anks1 UTSW 17 28051655 splice site probably null
R1639:Anks1 UTSW 17 28058306 missense probably damaging 1.00
R1816:Anks1 UTSW 17 27986573 missense probably damaging 1.00
R1981:Anks1 UTSW 17 27985121 missense probably damaging 1.00
R1982:Anks1 UTSW 17 27985121 missense probably damaging 1.00
R2041:Anks1 UTSW 17 28008414 missense probably damaging 1.00
R2099:Anks1 UTSW 17 27978491 critical splice donor site probably null
R2897:Anks1 UTSW 17 27985363 critical splice donor site probably null
R2965:Anks1 UTSW 17 28053905 missense probably benign
R3624:Anks1 UTSW 17 27986288 missense probably damaging 0.99
R4671:Anks1 UTSW 17 28051578 missense probably benign 0.45
R4786:Anks1 UTSW 17 28052730 missense possibly damaging 0.93
R4871:Anks1 UTSW 17 27991377 missense probably benign 0.00
R4936:Anks1 UTSW 17 27988805 missense probably damaging 1.00
R5175:Anks1 UTSW 17 28042588 missense probably damaging 1.00
R5908:Anks1 UTSW 17 27996019 missense probably damaging 1.00
R5975:Anks1 UTSW 17 27991447 intron probably null
R6226:Anks1 UTSW 17 28057330 missense probably benign 0.01
R6306:Anks1 UTSW 17 28050639 missense probably damaging 1.00
R6332:Anks1 UTSW 17 28052735 missense probably benign
R6995:Anks1 UTSW 17 28054299 missense probably damaging 1.00
R7465:Anks1 UTSW 17 28054323 missense possibly damaging 0.48
R7502:Anks1 UTSW 17 28008140 missense possibly damaging 0.48
R7749:Anks1 UTSW 17 28038141 missense probably damaging 0.96
R8005:Anks1 UTSW 17 28059367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTTTTGCTGCCTGTTGG -3'
(R):5'- TAGGAAACCAGGTGACACCC -3'

Sequencing Primer
(F):5'- TGTTGGCCACAGTCAGGG -3'
(R):5'- CAGGTGACACCCAGGCC -3'
Posted On2018-10-18