Incidental Mutation 'R4935:Plbd2'
ID380297
Institutional Source Beutler Lab
Gene Symbol Plbd2
Ensembl Gene ENSMUSG00000029598
Gene Namephospholipase B domain containing 2
Synonyms66.3 kDa, p76, 1300012G16Rik
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4935 (G1)
Quality Score198
Status Not validated
Chromosome5
Chromosomal Location120483282-120503625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120486721 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 461 (N461D)
Ref Sequence ENSEMBL: ENSMUSP00000031597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031597] [ENSMUST00000066540] [ENSMUST00000201684]
PDB Structure
Crystal structure of the lysosomal 66.3 kDa protein from mouse solved by S-SAD [X-RAY DIFFRACTION]
Two chain form of the 66.3 kDa protein at 1.8 Angstroem [X-RAY DIFFRACTION]
Two chain form of the 66.3 kDa protein from mouse lacking the linker peptide [X-RAY DIFFRACTION]
One chain form of the 66.3 kDa protein [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031597
AA Change: N461D

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031597
Gene: ENSMUSG00000029598
AA Change: N461D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Phospholip_B 62 591 2.9e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066540
SMART Domains Protein: ENSMUSP00000064849
Gene: ENSMUSG00000029597

DomainStartEndE-ValueType
Pfam:PALP 5 304 1.5e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151361
Predicted Effect probably benign
Transcript: ENSMUST00000201684
SMART Domains Protein: ENSMUSP00000143838
Gene: ENSMUSG00000029597

DomainStartEndE-ValueType
Pfam:PALP 5 304 1.5e-76 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Plbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Plbd2 APN 5 120485810 missense possibly damaging 0.57
IGL01635:Plbd2 APN 5 120499049 missense probably damaging 1.00
IGL02017:Plbd2 APN 5 120488558 missense probably damaging 1.00
IGL02040:Plbd2 APN 5 120487442 missense probably damaging 1.00
IGL03094:Plbd2 APN 5 120486780 missense probably damaging 1.00
IGL03124:Plbd2 APN 5 120493077 missense possibly damaging 0.68
R0077:Plbd2 UTSW 5 120486039 critical splice donor site probably null
R0087:Plbd2 UTSW 5 120494485 nonsense probably null
R0294:Plbd2 UTSW 5 120487449 unclassified probably null
R1682:Plbd2 UTSW 5 120485784 missense probably damaging 0.97
R1818:Plbd2 UTSW 5 120487509 splice site probably null
R3796:Plbd2 UTSW 5 120492868 missense probably damaging 1.00
R5082:Plbd2 UTSW 5 120491184 nonsense probably null
R5420:Plbd2 UTSW 5 120494482 missense probably damaging 0.98
R5441:Plbd2 UTSW 5 120499082 missense probably benign
R5582:Plbd2 UTSW 5 120493106 missense probably benign 0.00
R5643:Plbd2 UTSW 5 120493166 splice site probably null
R6831:Plbd2 UTSW 5 120493066 missense probably benign 0.03
R6859:Plbd2 UTSW 5 120503342 missense probably benign
R7343:Plbd2 UTSW 5 120493149 missense probably damaging 1.00
R7436:Plbd2 UTSW 5 120486796 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCCACCGCCTAGGAGAAAG -3'
(R):5'- TGACTACAGTGACAGCTGTCC -3'

Sequencing Primer
(F):5'- ACTCCCCAAGGATGGTAGC -3'
(R):5'- TACAGTGACAGCTGTCCCACTG -3'
Posted On2016-04-15