Incidental Mutation 'R6906:Vmn1r171'
ID538777
Institutional Source Beutler Lab
Gene Symbol Vmn1r171
Ensembl Gene ENSMUSG00000062483
Gene Namevomeronasal 1 receptor 171
SynonymsV3R7, V1rd7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6906 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location23630722-23634370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23632379 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 10 (V10I)
Ref Sequence ENSEMBL: ENSMUSP00000077552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078458] [ENSMUST00000226128] [ENSMUST00000226321] [ENSMUST00000226733] [ENSMUST00000226771] [ENSMUST00000227386] [ENSMUST00000227774] [ENSMUST00000227866] [ENSMUST00000228228] [ENSMUST00000228484] [ENSMUST00000228559] [ENSMUST00000228674] [ENSMUST00000228681]
Predicted Effect probably benign
Transcript: ENSMUST00000078458
AA Change: V10I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077552
Gene: ENSMUSG00000062483
AA Change: V10I

DomainStartEndE-ValueType
Pfam:TAS2R 20 307 1.7e-14 PFAM
Pfam:7tm_1 42 300 3.4e-7 PFAM
Pfam:V1R 53 307 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226128
Predicted Effect probably benign
Transcript: ENSMUST00000226321
Predicted Effect probably benign
Transcript: ENSMUST00000226733
Predicted Effect probably benign
Transcript: ENSMUST00000226771
Predicted Effect probably benign
Transcript: ENSMUST00000227386
Predicted Effect probably benign
Transcript: ENSMUST00000227774
Predicted Effect probably benign
Transcript: ENSMUST00000227866
Predicted Effect probably benign
Transcript: ENSMUST00000228228
Predicted Effect probably benign
Transcript: ENSMUST00000228484
Predicted Effect probably benign
Transcript: ENSMUST00000228559
Predicted Effect probably benign
Transcript: ENSMUST00000228674
Predicted Effect probably benign
Transcript: ENSMUST00000228681
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 A G 5: 24,568,842 F350L possibly damaging Het
Ahnak2 T A 12: 112,785,313 T305S probably benign Het
Anp32a A G 9: 62,377,569 probably benign Het
Aplf A G 6: 87,630,086 S449P possibly damaging Het
Arl6ip4 A G 5: 124,116,551 R36G possibly damaging Het
Ascc1 G A 10: 60,004,852 D12N probably benign Het
Bin1 C A 18: 32,421,925 H243Q probably benign Het
Ccdc7a C A 8: 128,935,681 V547L unknown Het
Cntnap5c T A 17: 58,395,307 N1207K probably benign Het
Coro7 C A 16: 4,633,304 R507L probably benign Het
Crtap T A 9: 114,381,632 K291N probably benign Het
Csmd3 T C 15: 47,847,173 T1569A probably benign Het
Dmrta1 A G 4: 89,691,966 T388A probably benign Het
Ehd3 T C 17: 73,830,338 F501L probably damaging Het
Fam126a A T 5: 23,999,958 W12R probably damaging Het
Fam160a2 G A 7: 105,388,269 T369I probably damaging Het
Fbn2 A C 18: 58,071,819 L1184R possibly damaging Het
Gm8251 C T 1: 44,056,013 S1975N probably benign Het
Hsf1 T C 15: 76,477,719 probably null Het
Kansl1l T C 1: 66,723,278 H810R possibly damaging Het
Lrp5 A T 19: 3,622,638 I557N probably damaging Het
Lypd1 T C 1: 125,910,459 E41G probably damaging Het
Mgam A G 6: 40,747,919 Y443C probably damaging Het
Muc2 A G 7: 141,698,733 D871G probably damaging Het
Nup85 T A 11: 115,580,943 Y198N probably damaging Het
Obscn T A 11: 59,032,918 M6578L possibly damaging Het
Olfr1097 T C 2: 86,890,747 T143A probably benign Het
Osbpl5 G C 7: 143,694,328 Q667E probably damaging Het
Ovgp1 T A 3: 105,986,873 probably benign Het
Prl8a2 T A 13: 27,348,917 N37K probably benign Het
Ptprf A T 4: 118,269,277 I93N possibly damaging Het
Rnf112 T C 11: 61,450,389 S457G probably null Het
Sema3e A G 5: 14,240,587 D562G probably damaging Het
Sesn3 A G 9: 14,325,641 M472V probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Shc3 T C 13: 51,466,559 T144A probably damaging Het
Sis A G 3: 72,919,485 L1287P probably damaging Het
Srrm2 C T 17: 23,820,363 P2090S probably damaging Het
Syne2 T G 12: 75,995,986 D3910E possibly damaging Het
Tcaim C T 9: 122,834,774 T443I probably benign Het
Tex19.1 T C 11: 121,147,122 V102A probably benign Het
Tpd52l1 T G 10: 31,332,954 T168P possibly damaging Het
Trdn G A 10: 33,233,948 C294Y probably benign Het
Trmt1l T C 1: 151,452,175 Y479H probably benign Het
Zbtb41 T A 1: 139,423,390 D80E possibly damaging Het
Zcchc4 A G 5: 52,823,634 K473E possibly damaging Het
Other mutations in Vmn1r171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Vmn1r171 APN 7 23632827 missense probably damaging 1.00
IGL02963:Vmn1r171 APN 7 23632688 missense possibly damaging 0.62
FR4304:Vmn1r171 UTSW 7 23632680 missense probably benign 0.26
R0412:Vmn1r171 UTSW 7 23632655 missense possibly damaging 0.81
R0602:Vmn1r171 UTSW 7 23633177 missense probably benign 0.01
R0710:Vmn1r171 UTSW 7 23633001 missense probably damaging 1.00
R1758:Vmn1r171 UTSW 7 23632356 missense probably benign 0.25
R2007:Vmn1r171 UTSW 7 23632587 missense probably damaging 1.00
R4153:Vmn1r171 UTSW 7 23632652 missense probably damaging 1.00
R4799:Vmn1r171 UTSW 7 23632944 missense probably benign 0.31
R5038:Vmn1r171 UTSW 7 23632763 missense probably benign 0.00
R6087:Vmn1r171 UTSW 7 23633004 missense probably damaging 1.00
R7745:Vmn1r171 UTSW 7 23632610 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACACAGATCTATCATGAGGAAAG -3'
(R):5'- ATCAAGGTATTGCCCACAGC -3'

Sequencing Primer
(F):5'- GATCTATCATGAGGAAAGAAAGAGC -3'
(R):5'- ATTGCCCACAGCTAAGTTGG -3'
Posted On2018-11-06