Incidental Mutation 'R5038:Vmn1r171'
ID393111
Institutional Source Beutler Lab
Gene Symbol Vmn1r171
Ensembl Gene ENSMUSG00000062483
Gene Namevomeronasal 1 receptor 171
SynonymsV3R7, V1rd7
MMRRC Submission 042628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5038 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location23630722-23634370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23632763 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 138 (M138V)
Ref Sequence ENSEMBL: ENSMUSP00000077552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078458] [ENSMUST00000226128] [ENSMUST00000226321] [ENSMUST00000226733] [ENSMUST00000226771] [ENSMUST00000227386] [ENSMUST00000227774] [ENSMUST00000227866] [ENSMUST00000228228] [ENSMUST00000228484] [ENSMUST00000228559] [ENSMUST00000228674] [ENSMUST00000228681]
Predicted Effect probably benign
Transcript: ENSMUST00000078458
AA Change: M138V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000077552
Gene: ENSMUSG00000062483
AA Change: M138V

DomainStartEndE-ValueType
Pfam:TAS2R 20 307 1.7e-14 PFAM
Pfam:7tm_1 42 300 3.4e-7 PFAM
Pfam:V1R 53 307 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226128
AA Change: M126V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000226321
AA Change: M126V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000226733
AA Change: M126V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000226771
AA Change: M126V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000227386
AA Change: M126V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000227774
AA Change: M126V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000227866
AA Change: M126V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228228
AA Change: M126V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228484
AA Change: M126V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228559
AA Change: M126V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228674
AA Change: M126V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228681
AA Change: M126V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 94% (64/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik A T 11: 11,589,375 probably null Het
Abtb2 G T 2: 103,567,063 G113C probably damaging Het
Acsm5 A G 7: 119,534,811 T272A probably damaging Het
Adprhl2 C T 4: 126,317,309 E272K possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Atp7b A C 8: 22,028,456 I122S possibly damaging Het
B230219D22Rik T C 13: 55,699,475 Y134H probably damaging Het
Bnc1 A G 7: 81,968,714 S868P probably damaging Het
Camta1 T C 4: 151,145,469 E302G probably damaging Het
Car1 A G 3: 14,770,873 Y129H probably damaging Het
Cdh22 T C 2: 165,142,277 T352A probably benign Het
Ckmt2 T C 13: 91,861,163 E215G probably benign Het
Cyb5r4 T G 9: 87,059,077 probably null Het
Dhrs13 A G 11: 78,032,430 probably benign Het
Dsg1c G A 18: 20,264,844 A34T probably benign Het
Epb41l1 T C 2: 156,521,410 V613A probably benign Het
Fam114a1 A G 5: 65,009,045 M240V probably damaging Het
Gm15455 T C 1: 33,838,176 noncoding transcript Het
Herc1 T G 9: 66,476,460 probably benign Het
Ifna11 T C 4: 88,820,077 V40A probably benign Het
Ifna15 T C 4: 88,558,029 N73D probably benign Het
Imp4 A T 1: 34,442,935 L45F probably damaging Het
Jak3 G A 8: 71,686,058 A967T probably damaging Het
Krtap19-2 A T 16: 88,874,028 Y76* probably null Het
Map4k5 A T 12: 69,824,614 N492K probably damaging Het
Mycbp2 C T 14: 103,296,939 R372H probably damaging Het
Nos2 G A 11: 78,922,314 S16N probably benign Het
Nr2c2 A G 6: 92,139,822 T2A probably damaging Het
Nup188 T C 2: 30,309,220 Y267H probably damaging Het
Nxph2 G A 2: 23,321,544 probably null Het
Olfr1446 T A 19: 12,890,406 H57L probably damaging Het
Olfr1461 T A 19: 13,165,591 D192E probably benign Het
Olfr1505 T A 19: 13,919,458 V146E possibly damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Pik3r1 C T 13: 101,689,444 R37Q probably damaging Het
Pkn3 T C 2: 30,085,281 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Ptpn14 T C 1: 189,786,886 S38P probably damaging Het
Raf1 G A 6: 115,620,235 Q35* probably null Het
Rps3a1 C A 3: 86,138,031 E251D probably benign Het
Scd1 C T 19: 44,401,709 V207M probably damaging Het
Shq1 A G 6: 100,630,993 V319A probably benign Het
Slc4a8 T C 15: 100,795,821 Y416H probably damaging Het
Slco1a5 T C 6: 142,262,637 T143A probably benign Het
Slco1a5 C T 6: 142,266,364 G90D probably damaging Het
Snx9 T C 17: 5,887,073 V30A probably benign Het
Spdya T C 17: 71,588,566 probably benign Het
Stat1 A T 1: 52,123,209 N75I probably damaging Het
Sv2b A T 7: 75,157,425 M159K probably damaging Het
Tdh A T 14: 63,496,126 Y89* probably null Het
Tmc7 A G 7: 118,543,365 F600S probably damaging Het
Trpa1 T A 1: 14,910,866 H104L probably damaging Het
Ttn G A 2: 76,848,640 probably benign Het
Vmn1r113 A G 7: 20,787,494 I70M possibly damaging Het
Zfc3h1 G A 10: 115,404,211 V550I probably benign Het
Zfp335 G T 2: 164,910,644 S60* probably null Het
Zfp7 T C 15: 76,891,810 M684T probably benign Het
Zfp984 T A 4: 147,755,446 H316L probably damaging Het
Zmym2 T A 14: 56,956,180 Y1151N possibly damaging Het
Other mutations in Vmn1r171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Vmn1r171 APN 7 23632827 missense probably damaging 1.00
IGL02963:Vmn1r171 APN 7 23632688 missense possibly damaging 0.62
FR4304:Vmn1r171 UTSW 7 23632680 missense probably benign 0.26
R0412:Vmn1r171 UTSW 7 23632655 missense possibly damaging 0.81
R0602:Vmn1r171 UTSW 7 23633177 missense probably benign 0.01
R0710:Vmn1r171 UTSW 7 23633001 missense probably damaging 1.00
R1758:Vmn1r171 UTSW 7 23632356 missense probably benign 0.25
R2007:Vmn1r171 UTSW 7 23632587 missense probably damaging 1.00
R4153:Vmn1r171 UTSW 7 23632652 missense probably damaging 1.00
R4799:Vmn1r171 UTSW 7 23632944 missense probably benign 0.31
R6087:Vmn1r171 UTSW 7 23633004 missense probably damaging 1.00
R6906:Vmn1r171 UTSW 7 23632379 missense probably benign 0.00
R7745:Vmn1r171 UTSW 7 23632610 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACTTAGCTGTGGGCAATACC -3'
(R):5'- AAATGACAAGATGCGCATGC -3'

Sequencing Primer
(F):5'- AGCTGTGGGCAATACCTTGATTC -3'
(R):5'- AGATGCGCATGCCTATACTG -3'
Posted On2016-06-15