Incidental Mutation 'R6928:Srebf2'
ID539868
Institutional Source Beutler Lab
Gene Symbol Srebf2
Ensembl Gene ENSMUSG00000022463
Gene Namesterol regulatory element binding factor 2
Synonymsnuc, bHLHd2, lop13, SREBP-2, SREBP2gc, SREBP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6928 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82147181-82205379 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 82203723 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 215 (R215*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023100] [ENSMUST00000179269] [ENSMUST00000229336] [ENSMUST00000229543]
Predicted Effect probably null
Transcript: ENSMUST00000023100
AA Change: R1067*
SMART Domains Protein: ENSMUSP00000023100
Gene: ENSMUSG00000022463
AA Change: R1067*

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 118 137 N/A INTRINSIC
low complexity region 178 204 N/A INTRINSIC
low complexity region 210 235 N/A INTRINSIC
HLH 325 375 3.54e-15 SMART
low complexity region 383 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179269
SMART Domains Protein: ENSMUSP00000137002
Gene: ENSMUSG00000096883

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Pfam:Shisa 55 189 1.7e-33 PFAM
low complexity region 234 246 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
low complexity region 310 328 N/A INTRINSIC
low complexity region 349 360 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000229336
AA Change: R1027*
Predicted Effect probably benign
Transcript: ENSMUST00000229543
Predicted Effect probably null
Transcript: ENSMUST00000230955
AA Change: R215*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.5%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the a ubiquitously expressed transcription factor that controls cholesterol homeostasis by regulating transcription of sterol-regulated genes. The encoded protein contains a basic helix-loop-helix-leucine zipper (bHLH-Zip) domain and binds the sterol regulatory element 1 motif. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele display prenatal lethality. Mice homozygous for an ENU mutation display cataracts and persistent wounds of the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,479,272 D215G possibly damaging Het
Asb3 A T 11: 30,998,326 M40L probably damaging Het
Aspg G A 12: 112,126,689 V547M possibly damaging Het
Aspm T A 1: 139,480,206 L2277* probably null Het
Atp7b A G 8: 21,994,812 S1295P probably benign Het
Cdca2 A G 14: 67,705,744 S199P probably damaging Het
Cdh1 A G 8: 106,661,010 E514G possibly damaging Het
Cenpk G T 13: 104,228,992 probably benign Het
Col6a5 C A 9: 105,939,919 V398L unknown Het
Colec10 A T 15: 54,462,606 K277N probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Cspg4 T A 9: 56,897,880 Y1992N possibly damaging Het
Drd3 G T 16: 43,821,320 R333L probably benign Het
Espl1 C T 15: 102,298,907 R269C probably benign Het
Esr2 C T 12: 76,165,478 C188Y probably damaging Het
Focad A G 4: 88,348,875 D1041G unknown Het
Frem3 T C 8: 80,611,282 F68S possibly damaging Het
Gapdh A G 6: 125,162,671 V212A probably damaging Het
Gm10471 A G 5: 26,085,588 probably null Het
Gm3854 T C 7: 6,354,267 Y360H probably damaging Het
Gm4778 T A 3: 94,266,548 C288S probably benign Het
Gm4858 G A 3: 93,073,960 C95Y probably damaging Het
Gzmb T C 14: 56,260,277 K169E probably benign Het
Hexdc T A 11: 121,212,054 F33I possibly damaging Het
Hsd3b6 T C 3: 98,810,953 I32V probably benign Het
Jcad T C 18: 4,673,372 V378A probably benign Het
Kcnmb2 T C 3: 32,199,041 S177P probably benign Het
Lrriq1 A T 10: 103,214,939 S651T possibly damaging Het
Map3k2 T C 18: 32,207,540 probably null Het
Mib1 T G 18: 10,802,282 S870A probably benign Het
Moap1 T A 12: 102,742,612 N226I probably damaging Het
Moxd1 T A 10: 24,300,288 N547K probably damaging Het
Mtmr9 A G 14: 63,543,593 V16A probably benign Het
Nme1 T C 11: 93,959,403 Y151C probably damaging Het
Nwd1 T C 8: 72,682,025 F879L probably benign Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr1451 A G 19: 12,999,838 N284S probably damaging Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr209 C A 16: 59,361,463 G252C probably damaging Het
Olfr655 A T 7: 104,596,589 Y197* probably null Het
Olfr930 T C 9: 38,930,566 Y132H probably damaging Het
Olfr935 T C 9: 38,994,632 M268V probably benign Het
Pcdhb21 A G 18: 37,514,421 E201G probably damaging Het
Plscr1 T C 9: 92,269,951 V301A possibly damaging Het
Psg28 A T 7: 18,423,078 S411T possibly damaging Het
Rif1 T C 2: 52,095,961 W653R probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rtn4 A G 11: 29,706,791 E199G possibly damaging Het
Sgpp1 T C 12: 75,716,570 Y279C probably damaging Het
Slc2a13 A G 15: 91,276,179 I524T probably damaging Het
Spg11 C T 2: 122,069,904 V1556I probably benign Het
Tmem19 T C 10: 115,347,274 N147S possibly damaging Het
Tpr T C 1: 150,408,785 S408P possibly damaging Het
Trav13d-4 C T 14: 53,073,161 T53I probably damaging Het
Trf T A 9: 103,222,108 R168W possibly damaging Het
Trim11 A G 11: 58,988,843 K273R probably damaging Het
Tsacc T A 3: 88,282,940 M68L probably benign Het
Ttn T A 2: 76,754,525 M22110L probably benign Het
Zfp160 G T 17: 21,041,462 G104V probably benign Het
Zranb1 G A 7: 132,966,594 R301H possibly damaging Het
Other mutations in Srebf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Srebf2 APN 15 82192203 unclassified probably benign
IGL01409:Srebf2 APN 15 82171218 missense probably damaging 1.00
IGL01415:Srebf2 APN 15 82177462 missense probably benign 0.08
IGL01614:Srebf2 APN 15 82178853 missense probably benign
IGL01985:Srebf2 APN 15 82192359 missense probably benign 0.01
IGL02423:Srebf2 APN 15 82175097 missense probably damaging 1.00
IGL02436:Srebf2 APN 15 82197727 missense probably benign 0.41
IGL02805:Srebf2 APN 15 82169844 missense probably benign 0.00
IGL02818:Srebf2 APN 15 82185374 missense probably damaging 0.99
IGL02823:Srebf2 APN 15 82199774 missense possibly damaging 0.87
IGL02895:Srebf2 APN 15 82147467 missense possibly damaging 0.72
IGL03064:Srebf2 APN 15 82192222 missense probably benign 0.01
IGL03378:Srebf2 APN 15 82169788 missense probably damaging 1.00
FR4449:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4548:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4737:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4976:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
R0230:Srebf2 UTSW 15 82182085 missense probably damaging 1.00
R0702:Srebf2 UTSW 15 82177409 missense probably damaging 1.00
R0829:Srebf2 UTSW 15 82177589 critical splice donor site probably null
R1241:Srebf2 UTSW 15 82177519 missense probably damaging 1.00
R1898:Srebf2 UTSW 15 82203735 missense probably damaging 1.00
R1957:Srebf2 UTSW 15 82194954 missense probably benign 0.26
R2395:Srebf2 UTSW 15 82192255 missense probably benign 0.26
R3771:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R3772:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R3773:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R4030:Srebf2 UTSW 15 82178783 missense probably damaging 1.00
R4613:Srebf2 UTSW 15 82185348 missense possibly damaging 0.94
R4670:Srebf2 UTSW 15 82192302 missense probably damaging 1.00
R4758:Srebf2 UTSW 15 82196169 missense probably benign 0.01
R4812:Srebf2 UTSW 15 82203825 missense probably damaging 0.98
R5058:Srebf2 UTSW 15 82182050 missense probably damaging 0.99
R5063:Srebf2 UTSW 15 82177451 missense probably benign
R5155:Srebf2 UTSW 15 82196226 missense probably damaging 1.00
R5166:Srebf2 UTSW 15 82185402 missense probably damaging 1.00
R5330:Srebf2 UTSW 15 82196208 missense possibly damaging 0.88
R5398:Srebf2 UTSW 15 82171242 missense probably damaging 1.00
R5662:Srebf2 UTSW 15 82195003 missense probably benign 0.01
R5668:Srebf2 UTSW 15 82192255 missense probably benign 0.26
R5867:Srebf2 UTSW 15 82169786 missense probably damaging 1.00
R6030:Srebf2 UTSW 15 82177276 splice site probably null
R6030:Srebf2 UTSW 15 82177276 splice site probably null
R7269:Srebf2 UTSW 15 82204069 missense probably benign 0.00
R7464:Srebf2 UTSW 15 82172874 missense probably damaging 0.97
R7632:Srebf2 UTSW 15 82185296 missense probably benign
R7831:Srebf2 UTSW 15 82182087 missense probably damaging 0.98
R7895:Srebf2 UTSW 15 82177240 missense probably benign 0.02
R7914:Srebf2 UTSW 15 82182087 missense probably damaging 0.98
R7978:Srebf2 UTSW 15 82177240 missense probably benign 0.02
R8002:Srebf2 UTSW 15 82178765 missense probably damaging 1.00
R8022:Srebf2 UTSW 15 82178765 missense probably damaging 1.00
X0064:Srebf2 UTSW 15 82175220 missense probably damaging 1.00
Z1088:Srebf2 UTSW 15 82194921 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACTTCGGATGTCCTCCCAG -3'
(R):5'- GCCCAGCTTGACAATCATCTG -3'

Sequencing Primer
(F):5'- GGGTTTGACTATCTCAGCCCAC -3'
(R):5'- TGACAATCATCTGCTGGCAG -3'
Posted On2018-11-06