Incidental Mutation 'R6948:Calhm3'
ID540992
Institutional Source Beutler Lab
Gene Symbol Calhm3
Ensembl Gene ENSMUSG00000094219
Gene Namecalcium homeostasis modulator 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6948 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location47151609-47157764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47151905 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 250 (M250L)
Ref Sequence ENSEMBL: ENSMUSP00000136302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178630]
Predicted Effect probably damaging
Transcript: ENSMUST00000178630
AA Change: M250L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136302
Gene: ENSMUSG00000094219
AA Change: M250L

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 1 252 1.9e-103 PFAM
low complexity region 268 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap2 A G 2: 91,267,179 T107A probably benign Het
Catsperb A T 12: 101,481,068 I276L probably benign Het
Ccdc129 C T 6: 55,978,485 T1026I probably benign Het
Cd70 T C 17: 57,149,594 E3G probably damaging Het
Cenpj A T 14: 56,553,226 S455R probably damaging Het
Cgn C G 3: 94,773,221 E590D probably benign Het
Cpvl T A 6: 53,896,483 I423F possibly damaging Het
Cyp2c54 T A 19: 40,046,192 M345L possibly damaging Het
Dner T C 1: 84,406,017 N549D probably damaging Het
Fat4 T A 3: 39,009,446 L4517Q probably damaging Het
Fbxw11 A G 11: 32,742,597 T523A probably damaging Het
Flg A G 3: 93,288,168 probably benign Het
Gcfc2 A G 6: 81,933,753 E237G probably benign Het
Ipo5 G T 14: 120,923,115 M181I probably benign Het
Klhl32 A G 4: 24,629,250 Y506H probably benign Het
Mast3 G A 8: 70,785,482 T505I probably damaging Het
Mrgprx2 A T 7: 48,482,716 V118D possibly damaging Het
Mtor T G 4: 148,536,752 V1869G probably benign Het
Mycbp2 A T 14: 103,285,267 M720K possibly damaging Het
Npy4r A G 14: 34,146,774 Y186H probably benign Het
Obscn A G 11: 59,106,316 S1520P probably damaging Het
Olfr1511 A T 14: 52,390,157 F205L probably benign Het
Pex1 A G 5: 3,605,994 N274D probably benign Het
Plxnb1 T C 9: 109,116,634 Y2078H probably damaging Het
Rasgrp1 T C 2: 117,298,604 D178G probably damaging Het
Reln A G 5: 21,972,035 S1878P probably damaging Het
Rims2 T C 15: 39,511,341 V1033A probably benign Het
Scaf1 G T 7: 45,013,547 S14* probably null Het
Serpinb9d A G 13: 33,200,723 S228G possibly damaging Het
Slc22a14 C A 9: 119,231,416 A93S probably damaging Het
Sox30 G A 11: 46,017,339 V778M probably damaging Het
Tecrl T C 5: 83,309,250 I128V probably benign Het
Trip10 T A 17: 57,262,448 C491S probably damaging Het
Vmn1r26 A T 6: 58,008,733 M157K probably damaging Het
Zbtb1 A T 12: 76,385,827 S196C probably damaging Het
Zfp236 T C 18: 82,644,062 D582G possibly damaging Het
Zfp384 A G 6: 125,024,910 T125A probably benign Het
Zpr1 T G 9: 46,273,641 probably null Het
Other mutations in Calhm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Calhm3 UTSW 19 47151896 frame shift probably null
R1203:Calhm3 UTSW 19 47155400 missense probably damaging 1.00
R1863:Calhm3 UTSW 19 47152100 missense probably damaging 1.00
R1911:Calhm3 UTSW 19 47155469 missense possibly damaging 0.74
R1951:Calhm3 UTSW 19 47151817 missense probably benign 0.00
R2089:Calhm3 UTSW 19 47151991 missense probably damaging 1.00
R2091:Calhm3 UTSW 19 47151991 missense probably damaging 1.00
R2273:Calhm3 UTSW 19 47157547 missense probably damaging 0.96
R2274:Calhm3 UTSW 19 47157547 missense probably damaging 0.96
R2436:Calhm3 UTSW 19 47151965 missense probably damaging 1.00
R3702:Calhm3 UTSW 19 47151748 missense possibly damaging 0.88
R5758:Calhm3 UTSW 19 47151751 missense probably damaging 0.99
R5901:Calhm3 UTSW 19 47157613 missense probably damaging 1.00
R5938:Calhm3 UTSW 19 47152077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTACTGAGGAGTTGATCCACC -3'
(R):5'- ACCGTGTGCAATACCAGAG -3'

Sequencing Primer
(F):5'- GAGTTGATCCACCTGCTCCCG -3'
(R):5'- CATCGGCTGGAGTATAACCTTGC -3'
Posted On2018-11-28