Incidental Mutation 'R7037:Tomm34'
ID546748
Institutional Source Beutler Lab
Gene Symbol Tomm34
Ensembl Gene ENSMUSG00000018322
Gene Nametranslocase of outer mitochondrial membrane 34
Synonyms2610100K07Rik, TOM34
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R7037 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location164053540-164071169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164070478 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 39 (L39P)
Ref Sequence ENSEMBL: ENSMUSP00000018466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018353] [ENSMUST00000018466] [ENSMUST00000109384] [ENSMUST00000134078]
Predicted Effect probably benign
Transcript: ENSMUST00000018353
SMART Domains Protein: ENSMUSP00000018353
Gene: ENSMUSG00000018209

DomainStartEndE-ValueType
S_TKc 30 281 1.97e-104 SMART
low complexity region 311 326 N/A INTRINSIC
Pfam:Mst1_SARAH 433 480 2.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000018466
AA Change: L39P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018466
Gene: ENSMUSG00000018322
AA Change: L39P

DomainStartEndE-ValueType
TPR 9 42 1.4e1 SMART
TPR 51 84 4.21e-3 SMART
TPR 85 118 2.55e-2 SMART
low complexity region 167 182 N/A INTRINSIC
TPR 193 226 1.56e1 SMART
TPR 227 260 5.51e-7 SMART
TPR 261 294 3.67e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109384
SMART Domains Protein: ENSMUSP00000105010
Gene: ENSMUSG00000018322

DomainStartEndE-ValueType
TPR 9 42 1.73e1 SMART
TPR 51 84 4.21e-3 SMART
TPR 85 118 2.55e-2 SMART
low complexity region 167 182 N/A INTRINSIC
TPR 193 226 1.56e1 SMART
TPR 227 260 5.51e-7 SMART
TPR 261 294 3.67e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134078
SMART Domains Protein: ENSMUSP00000122440
Gene: ENSMUSG00000018209

DomainStartEndE-ValueType
Pfam:Pkinase 29 113 7.2e-22 PFAM
Pfam:Pkinase_Tyr 29 113 1.1e-17 PFAM
Meta Mutation Damage Score 0.3433 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the import of precursor proteins into mitochondria. The encoded protein has a chaperone-like activity, binding the mature portion of unfolded proteins and aiding their import into mitochondria. This protein, which is found in the cytoplasm and sometimes associated with the outer mitochondrial membrane, has a weak ATPase activity and contains 6 TPR repeats. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and males do not display any defects in the testes or in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,768,043 N33I probably damaging Het
Ahnak2 A T 12: 112,774,278 V314D probably damaging Het
Arl14epl T G 18: 46,932,443 C92G probably benign Het
Atp6v1h T A 1: 5,149,992 M423K possibly damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b C T 2: 59,933,670 probably null Het
Bicral T C 17: 46,824,634 H550R probably benign Het
C1rl A G 6: 124,508,639 Y323C probably damaging Het
Ccr9 T A 9: 123,779,971 H239Q possibly damaging Het
Cdh16 T A 8: 104,617,635 R91* probably null Het
Coro1c A G 5: 113,845,396 F357S possibly damaging Het
Cpsf4 G A 5: 145,176,129 R141Q possibly damaging Het
Cryzl2 G A 1: 157,470,748 V236I probably damaging Het
Cttnbp2 T C 6: 18,435,118 E247G probably damaging Het
Dbr1 T A 9: 99,576,568 probably null Het
Dclk1 T C 3: 55,463,048 S23P probably damaging Het
Diexf A C 1: 193,120,723 probably null Het
Dpyd A T 3: 118,899,289 I361F probably benign Het
Elac2 A G 11: 64,983,711 E218G probably benign Het
Eml4 T A 17: 83,425,327 D136E probably benign Het
Fam198a G T 9: 121,965,526 V249L possibly damaging Het
Fam71e2 G T 7: 4,758,585 probably benign Het
Foxred1 A T 9: 35,207,548 S223T probably benign Het
Gm11595 A G 11: 99,772,648 C69R unknown Het
Gm14124 G T 2: 150,266,456 V46F possibly damaging Het
Gna14 A T 19: 16,533,764 H59L Het
H2-Ab1 T A 17: 34,267,989 I239N probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Itgb4 T A 11: 116,005,565 Y1379* probably null Het
Kank1 A G 19: 25,430,341 D1233G probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lrrc66 A T 5: 73,607,161 D846E probably benign Het
Lyst A G 13: 13,616,666 H38R probably damaging Het
Mc3r T C 2: 172,249,634 F259L probably damaging Het
Med25 A G 7: 44,882,782 Y384H probably damaging Het
Met A T 6: 17,547,128 probably benign Het
Mmp16 T C 4: 18,116,148 V584A possibly damaging Het
Mpp5 T A 12: 78,797,199 I59N probably damaging Het
Mrgprb3 A G 7: 48,643,194 L203P probably damaging Het
Mus81 A G 19: 5,486,080 L185P probably damaging Het
Naaa A G 5: 92,277,075 V75A possibly damaging Het
Obscn T A 11: 59,043,929 T5292S probably damaging Het
Obscn T C 11: 59,052,604 S4801G probably damaging Het
Olfr703 T C 7: 106,845,336 S242P probably damaging Het
Otof T C 5: 30,381,538 D1112G probably benign Het
Pbx4 A G 8: 69,864,875 R170G probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plce1 A T 19: 38,702,017 D715V probably damaging Het
Pms1 T C 1: 53,207,611 T311A possibly damaging Het
Popdc2 A G 16: 38,374,267 D350G probably damaging Het
Prex1 A G 2: 166,587,180 V661A probably benign Het
Ptbp2 A G 3: 119,751,908 Y130H probably damaging Het
Rev3l C T 10: 39,851,975 R2707W probably damaging Het
Rpl37 G A 15: 5,117,703 R75K probably null Het
Ryr3 T A 2: 112,949,130 R259* probably null Het
Scai A T 2: 39,190,621 S8T probably benign Het
Scn4a C A 11: 106,320,900 L1430F probably damaging Het
Sema5a A G 15: 32,686,847 K1035R probably damaging Het
Siah3 A G 14: 75,525,585 H92R probably benign Het
Smc4 G A 3: 69,018,195 V342I possibly damaging Het
Spata31d1a C T 13: 59,700,324 C1330Y possibly damaging Het
St18 C A 1: 6,803,036 H332N possibly damaging Het
Sycp1 T A 3: 102,898,934 E480D possibly damaging Het
Tex14 A T 11: 87,497,915 I323F probably damaging Het
Tm7sf2 A T 19: 6,064,077 probably null Het
Tmem241 G T 18: 12,113,406 H62Q probably benign Het
Tmem54 T A 4: 129,110,801 probably null Het
Triml2 T A 8: 43,193,536 V354D probably damaging Het
Usp19 T C 9: 108,496,958 I738T possibly damaging Het
Utrn T A 10: 12,826,770 probably null Het
Other mutations in Tomm34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Tomm34 APN 2 164058662 splice site probably benign
IGL02426:Tomm34 APN 2 164064955 missense probably damaging 1.00
R0744:Tomm34 UTSW 2 164070976 missense probably benign 0.34
R1938:Tomm34 UTSW 2 164061006 missense probably benign 0.00
R4506:Tomm34 UTSW 2 164054372 unclassified probably null
R4541:Tomm34 UTSW 2 164054799 missense probably benign 0.03
R4869:Tomm34 UTSW 2 164054717 missense probably damaging 1.00
R5080:Tomm34 UTSW 2 164070896 intron probably benign
R6106:Tomm34 UTSW 2 164060991 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGACAGGTGCGCTAGCTATATG -3'
(R):5'- ACTTCCGCAATGGCCAGTAC -3'

Sequencing Primer
(F):5'- CTATATGCGGGGGCGTG -3'
(R):5'- TTAAGGGCACGCATCCG -3'
Posted On2019-05-13