Mutagenetix > Incidental Mutations

Incidental Mutation 'R7046:Napsa'

547316

Institutional Source

Beutler Lab

Gene Symbol

Napsa

Ensembl Gene

ENSMUSG00000002204

Gene Name

napsin A aspartic peptidase

Synonyms

Kdap, NAP1, napsin, pronapsin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.129) question?

Stock #

R7046 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44572380-44586862 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44585085 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 247 (V247A)

Ref Sequence

ENSEMBL: ENSMUSP00000002274 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002274] [ENSMUST00000208514]

Predicted Effect

probably damaging
Transcript: ENSMUST00000002274
AA Change: V247A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000002274
Gene: ENSMUSG00000002204
AA Change: V247A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Asp	72	396	6.6e-109	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000208514

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein is proteolytically processed to generate an activation peptide and the mature protease. The activation peptides of aspartic proteinases function as inhibitors of the protease active site. These peptide segments, or pro-parts, are deemed important for correct folding, targeting, and control of the activation of aspartic proteinase zymogens. The encoded protease may play a role in the proteolytic processing of pulmonary surfactant protein B in the lung and may function in protein catabolism in the renal proximal tubules. This gene has been described as a marker for lung adenocarcinoma and renal cell carcinoma. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	T	C	7: 46,122,940	Y805C	probably damaging	Het
Cabp7	T	A	11: 4,738,886	I195F	probably damaging	Het
Camsap1	T	C	2: 25,945,189	N317S	probably damaging	Het
Ccdc127	T	G	13: 74,352,875	L4V	probably damaging	Het
Ccdc7a	T	C	8: 129,047,619	E145G	probably damaging	Het
Cdh10	T	A	15: 19,013,201	V629D	probably damaging	Het
Cdh23	A	C	10: 60,378,751	L1497R	probably damaging	Het
Chsy3	A	G	18: 59,409,803	K671R	probably benign	Het
Clca4b	T	C	3: 144,915,606	Y569C	probably damaging	Het
Cnga1	T	C	5: 72,629,353		probably benign	Het
Cyp51	T	A	5: 4,100,188	E178D	probably damaging	Het
Defa30	T	A	8: 21,135,455	N78K	probably benign	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Dnah14	G	T	1: 181,623,003	C727F	probably benign	Het
Egf	A	T	3: 129,754,958	W3R	unknown	Het
Egfem1	G	A	3: 29,082,215		probably null	Het
Epb41l1	G	T	2: 156,526,892	V682L	possibly damaging	Het
Etv1	A	G	12: 38,784,370		probably null	Het
Faap100	A	G	11: 120,377,374	F191S	possibly damaging	Het
Fam208a	A	T	14: 27,472,435	L1197F	probably damaging	Het
Fmo1	T	A	1: 162,839,694	D184V	possibly damaging	Het
Ghrl	A	G	6: 113,719,383	L16P	probably damaging	Het
Gria4	T	A	9: 4,420,278	L861F	probably damaging	Het
Gsr	T	A	8: 33,695,062	M428K	probably damaging	Het
Hspa5	C	T	2: 34,773,192	P127L	probably damaging	Het
Kbtbd12	A	G	6: 88,618,515	M111T	possibly damaging	Het
Krtap21-1	G	T	16: 89,403,735	Y6*	probably null	Het
Lin9	A	G	1: 180,667,370	D219G	probably damaging	Het
Lrrc38	A	G	4: 143,350,169	M1V	probably null	Het
Macc1	T	G	12: 119,447,038	F514V	probably benign	Het
Madcam1	C	T	10: 79,668,305	R242C	probably benign	Het
Mfhas1	T	C	8: 35,664,790	S1037P	probably benign	Het
Micall2	C	T	5: 139,708,944		probably benign	Het
Mtr	C	A	13: 12,190,209	A1122S	possibly damaging	Het
Muc6	T	A	7: 141,640,189		probably benign	Het
Myh15	T	A	16: 49,109,299	C529*	probably null	Het
Nr2c2	A	G	6: 92,158,357	T309A	probably damaging	Het
Olfr133	A	T	17: 38,148,800	M71L	probably benign	Het
Olfr357	T	A	2: 36,997,161	V117E	probably benign	Het
Olfr385	A	T	11: 73,589,732	I2K	probably benign	Het
Osgepl1	A	T	1: 53,321,551	I384F	possibly damaging	Het
Otud4	C	T	8: 79,651,042	L111F	possibly damaging	Het
Pds5b	A	G	5: 150,749,920	Y481C	probably damaging	Het
Pdzrn4	T	A	15: 92,770,422	Y818*	probably null	Het
Pin1rt1	T	C	2: 104,714,422	S122G	probably benign	Het
Pkdcc	A	T	17: 83,224,258	Y487F	probably damaging	Het
Plxna4	C	T	6: 32,516,505	C392Y	probably damaging	Het
Psd4	T	G	2: 24,394,973	M283R	probably benign	Het
Ralgds	G	T	2: 28,540,729	G68W	probably damaging	Het
Rmdn2	T	A	17: 79,621,379	I20N	probably damaging	Het
Sestd1	A	G	2: 77,192,566	V486A	probably benign	Het
Svs1	T	A	6: 48,987,578	D173E	probably benign	Het
Tango6	A	G	8: 106,807,116	H958R	possibly damaging	Het
Taok3	C	T	5: 117,273,706	R857C	probably damaging	Het
Theg	G	T	10: 79,586,962	D35E	probably benign	Het
Trio	T	C	15: 27,832,051	E1245G	probably damaging	Het
Usp19	C	T	9: 108,497,135	H763Y	possibly damaging	Het
Vmn1r185	A	G	7: 26,611,226	S285P	probably damaging	Het
Vmn1r45	T	G	6: 89,933,556	Y144S	probably benign	Het
Vwa3b	G	A	1: 37,173,878	E152K	probably benign	Het
Wdr61	T	A	9: 54,719,255	D275V	probably damaging	Het
Xrcc5	G	A	1: 72,394,716	M731I	probably benign	Het
Zfp619	G	A	7: 39,537,363	S939N	possibly damaging	Het
Zfp874a	C	A	13: 67,442,299	C422F	probably damaging	Het
Zfp948	A	G	17: 21,588,457	D637G	possibly damaging	Het

Other mutations in Napsa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Napsa	APN	7	44581421	missense	probably benign	0.00
IGL01380:Napsa	APN	7	44586674	missense	probably damaging	0.99
IGL01521:Napsa	APN	7	44586637	missense	probably damaging	1.00
IGL01630:Napsa	APN	7	44586665	missense	probably damaging	1.00
IGL01862:Napsa	APN	7	44582493	missense	probably damaging	0.99
IGL01935:Napsa	APN	7	44586622	missense	probably benign	0.01
IGL02421:Napsa	APN	7	44585055	missense	probably damaging	1.00
IGL02831:Napsa	APN	7	44586760	missense	probably benign
IGL03008:Napsa	APN	7	44585796	missense	possibly damaging	0.77
PIT4131001:Napsa	UTSW	7	44581451	missense	probably damaging	1.00
R0422:Napsa	UTSW	7	44585106	missense	probably damaging	1.00
R1542:Napsa	UTSW	7	44581689	missense	probably damaging	1.00
R1564:Napsa	UTSW	7	44586649	missense	probably damaging	1.00
R1903:Napsa	UTSW	7	44581736	missense	probably damaging	1.00
R1964:Napsa	UTSW	7	44581685	missense	probably benign	0.01
R2366:Napsa	UTSW	7	44582485	missense	probably damaging	1.00
R3713:Napsa	UTSW	7	44581428	missense	probably damaging	1.00
R5441:Napsa	UTSW	7	44581393	unclassified	probably benign
R5512:Napsa	UTSW	7	44572616	start codon destroyed	probably null	0.01
R5682:Napsa	UTSW	7	44585344	missense	possibly damaging	0.92
R6290:Napsa	UTSW	7	44581337	missense	probably benign	0.00
R7134:Napsa	UTSW	7	44585735	missense	probably benign	0.04
R7677:Napsa	UTSW	7	44581706	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCATCTAGAAGCCAACTGGAG -3'
(R):5'- ACTAGGTCCTGTGATGAGGG -3'

Sequencing Primer
(F):5'- ACTGGAGGAAGTCCCATCC -3'
(R):5'- TGTCTAGGATGGCACTGCAGC -3'

Posted On

2019-05-13