Incidental Mutation 'R7082:Trpc4'
ID549584
Institutional Source Beutler Lab
Gene Symbol Trpc4
Ensembl Gene ENSMUSG00000027748
Gene Nametransient receptor potential cation channel, subfamily C, member 4
SynonymsTrrp4, STRPC4, Trp4, CCE1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7082 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location54156035-54318471 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 54299098 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 573 (W573*)
Ref Sequence ENSEMBL: ENSMUSP00000029311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029311] [ENSMUST00000200048] [ENSMUST00000200341]
Predicted Effect probably null
Transcript: ENSMUST00000029311
AA Change: W573*
SMART Domains Protein: ENSMUSP00000029311
Gene: ENSMUSG00000027748
AA Change: W573*

DomainStartEndE-ValueType
Blast:ANK 33 63 4e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.2e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 4.2e-33 PFAM
low complexity region 763 780 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200048
AA Change: W573*
SMART Domains Protein: ENSMUSP00000143593
Gene: ENSMUSG00000027748
AA Change: W573*

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.1e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 3.5e-33 PFAM
low complexity region 763 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200341
SMART Domains Protein: ENSMUSP00000142921
Gene: ENSMUSG00000027748

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 6.4e-33 PFAM
transmembrane domain 331 351 N/A INTRINSIC
transmembrane domain 366 383 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the canonical subfamily of transient receptor potential cation channels. The encoded protein forms a non-selective calcium-permeable cation channel that is activated by Gq-coupled receptors and tyrosine kinases, and plays a role in multiple processes including endothelial permeability, vasodilation, neurotransmitter release and cell proliferation. Single nucleotide polymorphisms in this gene may be associated with generalized epilepsy with photosensitivity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit a significant reduction in agonist-induced Ca2+ entry and vasorelaxation of aortic rings. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,280 N109Y unknown Het
A430005L14Rik C T 4: 153,959,764 R11W probably damaging Het
Aadacl2 T A 3: 60,024,885 S274T probably damaging Het
Ahctf1 T C 1: 179,775,333 R887G probably benign Het
Aox4 G T 1: 58,224,193 R158L possibly damaging Het
Atp10a T C 7: 58,658,819 I122T probably damaging Het
Batf2 G T 19: 6,171,375 A72S possibly damaging Het
Bptf T C 11: 107,086,747 D749G probably benign Het
Cacybp A G 1: 160,203,659 Y200H probably damaging Het
Cdc40 A T 10: 40,867,873 V76D probably benign Het
Cdc42ep4 T C 11: 113,729,118 D149G probably benign Het
Chtop A G 3: 90,507,584 V9A probably benign Het
Cnot9 A G 1: 74,527,006 I185M probably damaging Het
Col6a5 A G 9: 105,931,239 I870T unknown Het
Cr1l A G 1: 195,123,698 I159T probably benign Het
Cthrc1 T C 15: 39,077,100 S33P probably benign Het
Dlg2 T A 7: 90,731,984 W44R probably benign Het
Dlgap4 T C 2: 156,748,422 probably null Het
Dna2 A G 10: 62,954,317 H193R possibly damaging Het
Espnl T A 1: 91,334,799 F322Y probably benign Het
Fam171a1 G A 2: 3,223,475 V293I probably benign Het
Fam76b A G 9: 13,833,012 Y135C probably damaging Het
Flvcr2 A T 12: 85,746,954 I35F probably benign Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm14548 C T 7: 3,895,511 V313M probably damaging Het
Gm9195 T A 14: 72,442,712 Q2219L probably benign Het
Gm9573 A T 17: 35,621,201 S698T unknown Het
Gnptg T C 17: 25,234,720 T283A probably benign Het
Grap2 G A 15: 80,648,498 V289M probably benign Het
Hk3 T C 13: 55,006,897 T767A probably benign Het
Hs3st5 A G 10: 36,832,837 I123V probably benign Het
Il6st A G 13: 112,504,032 T781A probably damaging Het
Inpp5d T A 1: 87,695,380 H398Q probably damaging Het
Kcnk1 A G 8: 125,995,548 Y30C probably damaging Het
Klhl6 T C 16: 19,982,883 T41A probably benign Het
Krt14 G A 11: 100,203,341 H476Y possibly damaging Het
Lingo3 G C 10: 80,835,791 R102G probably benign Het
Map3k9 G A 12: 81,724,702 T704M probably damaging Het
Mdn1 C A 4: 32,762,341 N5088K probably benign Het
Mmp9 T A 2: 164,948,892 S67T probably benign Het
Mrps18c A G 5: 100,804,404 E143G probably damaging Het
Nags C A 11: 102,147,472 R335S possibly damaging Het
Nars A G 18: 64,504,354 V385A possibly damaging Het
Nipal2 A C 15: 34,584,663 V253G possibly damaging Het
Nos2 C A 11: 78,928,579 T39K probably benign Het
Olfr1411 G A 1: 92,596,418 probably benign Het
Olfr574 T C 7: 102,949,248 V261A probably damaging Het
Olfr601 C A 7: 103,358,288 R302L possibly damaging Het
Olfr796 T A 10: 129,607,547 *311Y probably null Het
Olfr796 T A 10: 129,607,548 *311L probably null Het
Olfr798 C T 10: 129,625,765 V99M probably benign Het
Panx3 G A 9: 37,666,617 P106S probably benign Het
Pappa2 G A 1: 158,763,119 T1655I possibly damaging Het
Pcdhb1 A G 18: 37,266,991 D665G probably damaging Het
Pde2a T C 7: 101,508,096 L676P probably damaging Het
Pf4 A G 5: 90,772,992 T60A possibly damaging Het
Pld5 A T 1: 176,089,876 C164S probably benign Het
Psd3 A T 8: 67,904,148 M640K probably benign Het
Ptf1a A G 2: 19,445,865 D2G possibly damaging Het
Ptprq C T 10: 107,708,730 C313Y probably benign Het
Ranbp10 A G 8: 105,773,946 S467P probably damaging Het
Rap1gap C T 4: 137,718,936 T333M probably damaging Het
Rfpl4 A G 7: 5,115,559 L4P probably benign Het
Rgs12 A G 5: 34,966,706 N611S probably benign Het
Sacs C A 14: 61,210,517 N3337K possibly damaging Het
Sbno2 A T 10: 80,060,090 probably null Het
Scrn2 T A 11: 97,033,082 V264E possibly damaging Het
Serpinb9c T A 13: 33,154,407 I198L probably benign Het
Shank2 T C 7: 144,410,359 F568S probably damaging Het
Slc47a1 C T 11: 61,377,941 R36Q probably benign Het
Slc4a8 A C 15: 100,791,027 E406A probably damaging Het
Speg C T 1: 75,411,447 T1483I probably damaging Het
Srbd1 A G 17: 86,057,732 V632A probably damaging Het
Srd5a2 A T 17: 74,021,520 Y188N probably damaging Het
Sspo A T 6: 48,478,609 probably null Het
Ssx2ip A T 3: 146,430,948 D317V probably benign Het
Tmco3 G T 8: 13,320,847 E172* probably null Het
Ttn T C 2: 76,749,996 I23518V probably benign Het
Tubal3 A G 13: 3,933,050 T277A possibly damaging Het
Uhrf1bp1 G T 17: 27,890,065 R1086L probably damaging Het
Unc5b A T 10: 60,775,088 L391H probably damaging Het
Vmn2r76 A G 7: 86,225,232 F846L probably benign Het
Vps13c T A 9: 67,883,453 Y338N probably damaging Het
Zc3hav1 G T 6: 38,332,393 S498* probably null Het
Zfand4 T A 6: 116,328,376 probably null Het
Zfp451 A T 1: 33,772,891 probably null Het
Zfp607a A T 7: 27,878,758 I418F probably damaging Het
Zfp612 A G 8: 110,089,705 T515A probably damaging Het
Zfp708 G T 13: 67,071,136 L208I possibly damaging Het
Other mutations in Trpc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Trpc4 APN 3 54302175 missense probably damaging 1.00
IGL01067:Trpc4 APN 3 54222562 missense probably benign 0.01
IGL01475:Trpc4 APN 3 54266407 missense possibly damaging 0.87
IGL01544:Trpc4 APN 3 54302146 missense probably damaging 0.99
IGL01688:Trpc4 APN 3 54266074 splice site probably benign
IGL02134:Trpc4 APN 3 54315654 missense possibly damaging 0.46
IGL02237:Trpc4 APN 3 54222362 missense probably damaging 1.00
IGL02301:Trpc4 APN 3 54291232 missense probably damaging 0.97
IGL02549:Trpc4 APN 3 54222349 missense possibly damaging 0.92
IGL02742:Trpc4 APN 3 54299246 missense probably damaging 1.00
IGL02815:Trpc4 APN 3 54299274 splice site probably benign
R0498:Trpc4 UTSW 3 54291211 missense probably damaging 1.00
R0555:Trpc4 UTSW 3 54302090 splice site probably benign
R0609:Trpc4 UTSW 3 54194768 missense probably damaging 1.00
R1351:Trpc4 UTSW 3 54195002 missense probably damaging 1.00
R1595:Trpc4 UTSW 3 54315815 missense probably benign 0.02
R1623:Trpc4 UTSW 3 54299179 missense probably damaging 1.00
R1763:Trpc4 UTSW 3 54194822 missense possibly damaging 0.90
R1843:Trpc4 UTSW 3 54279994 missense probably benign 0.19
R1856:Trpc4 UTSW 3 54279989 missense probably damaging 1.00
R1936:Trpc4 UTSW 3 54279890 missense probably damaging 1.00
R2196:Trpc4 UTSW 3 54302193 missense probably benign 0.03
R2441:Trpc4 UTSW 3 54222283 missense probably damaging 0.96
R2877:Trpc4 UTSW 3 54291340 missense probably damaging 1.00
R3846:Trpc4 UTSW 3 54318012 missense probably benign 0.22
R3931:Trpc4 UTSW 3 54318095 missense probably damaging 1.00
R4854:Trpc4 UTSW 3 54302218 missense probably damaging 1.00
R5024:Trpc4 UTSW 3 54194796 missense probably benign 0.11
R5284:Trpc4 UTSW 3 54279947 missense probably damaging 0.99
R5320:Trpc4 UTSW 3 54299178 missense probably damaging 0.99
R5973:Trpc4 UTSW 3 54315842 missense probably damaging 1.00
R6276:Trpc4 UTSW 3 54318020 missense probably benign 0.25
R6335:Trpc4 UTSW 3 54317574 critical splice donor site probably null
R7215:Trpc4 UTSW 3 54194896 missense possibly damaging 0.83
R7299:Trpc4 UTSW 3 54317627 missense possibly damaging 0.87
R7423:Trpc4 UTSW 3 54318029 missense probably benign
R7459:Trpc4 UTSW 3 54291232 missense probably damaging 0.97
R7538:Trpc4 UTSW 3 54318095 missense possibly damaging 0.92
R7542:Trpc4 UTSW 3 54315654 missense probably damaging 1.00
R7823:Trpc4 UTSW 3 54302219 nonsense probably null
R7868:Trpc4 UTSW 3 54302286 missense probably benign 0.00
R7951:Trpc4 UTSW 3 54302286 missense probably benign 0.00
X0066:Trpc4 UTSW 3 54194750 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGGTTCCAATGCCCTTTG -3'
(R):5'- CAACTTACGGCAATTAGTTGGTAAG -3'

Sequencing Primer
(F):5'- GCCCTTTGGATAGTATAGTAA -3'
(R):5'- CGGCAATTAGTTGGTAAGAATTATTC -3'
Posted On2019-05-15