Incidental Mutation 'R0595:Atp6v1e1'
ID55058
Institutional Source Beutler Lab
Gene Symbol Atp6v1e1
Ensembl Gene ENSMUSG00000019210
Gene NameATPase, H+ transporting, lysosomal V1 subunit E1
Synonyms2410029D23Rik, E2, Atp6e2, Atp6e, H+ ATPase subunit E, H(+)-ATPase E-like protein, Atp6v1e, lysosomal 31kDa, D6Ertd385e
MMRRC Submission 038785-MU
Accession Numbers

Genbank: NM_007510; MGI: 894326 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0595 (G1)
Quality Score208
Status Validated
Chromosome6
Chromosomal Location120794305-120822793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120801130 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000019354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019354] [ENSMUST00000203783] [ENSMUST00000205049]
Predicted Effect probably benign
Transcript: ENSMUST00000019354
AA Change: V148A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000019354
Gene: ENSMUSG00000019210
AA Change: V148A

DomainStartEndE-ValueType
Pfam:vATP-synt_E 18 216 7.6e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203527
Predicted Effect probably benign
Transcript: ENSMUST00000203783
SMART Domains Protein: ENSMUSP00000145324
Gene: ENSMUSG00000019210

DomainStartEndE-ValueType
Pfam:vATP-synt_E 7 118 2.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205049
SMART Domains Protein: ENSMUSP00000145353
Gene: ENSMUSG00000019210

DomainStartEndE-ValueType
Pfam:vATP-synt_E 5 87 1e-26 PFAM
Meta Mutation Damage Score 0.4419 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain E subunit isoforms. Pseudogenes for this gene have been found in the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,740,417 D1093E probably damaging Het
Aldh2 G T 5: 121,573,500 A276D probably damaging Het
Aldh2 C T 5: 121,573,501 A276T probably damaging Het
Aldh7a1 C T 18: 56,546,893 probably benign Het
Ano1 C T 7: 144,590,153 R964H possibly damaging Het
Apob G A 12: 8,008,369 V2251I probably benign Het
Bbs9 T A 9: 22,496,815 H73Q probably benign Het
Brca1 A G 11: 101,524,887 V807A probably benign Het
Cacna1b C T 2: 24,649,989 probably benign Het
Cadps2 A T 6: 23,321,704 probably null Het
Cep152 T C 2: 125,595,063 Q519R probably damaging Het
Cep295 A C 9: 15,332,191 Y1608* probably null Het
Cfap54 T C 10: 92,884,736 I2619V unknown Het
Dnajb9 A G 12: 44,208,284 V7A probably benign Het
Ep400 T C 5: 110,703,542 K1358R unknown Het
Fbxw7 C A 3: 84,977,367 probably null Het
Fsip2 T C 2: 82,946,952 Y108H probably damaging Het
Ggt6 T A 11: 72,437,667 L331Q probably damaging Het
Ifitm1 T A 7: 140,968,329 I25N possibly damaging Het
Krt75 C T 15: 101,568,354 E367K probably damaging Het
Lifr A G 15: 7,177,469 Y487C probably damaging Het
Map3k6 G T 4: 133,241,263 G59W probably damaging Het
Mme A G 3: 63,328,181 T129A probably benign Het
Mmp10 G A 9: 7,508,198 E442K probably benign Het
Myh13 T C 11: 67,344,846 S646P probably benign Het
Nbea A T 3: 55,628,496 I2889N probably benign Het
Nlrp4d T A 7: 10,381,045 K581N probably benign Het
Nr3c2 C T 8: 76,909,604 P445S possibly damaging Het
Olfr487 A T 7: 108,211,661 N289K probably damaging Het
Pck1 T A 2: 173,157,029 V360E probably damaging Het
Plekha7 T C 7: 116,144,968 D766G probably damaging Het
Prag1 A G 8: 36,147,002 N1236S probably damaging Het
Prkdc A C 16: 15,808,088 Q3326P probably damaging Het
Prrc2b T C 2: 32,183,177 M57T probably damaging Het
Rb1 A T 14: 73,273,680 F330I probably damaging Het
Rufy4 A G 1: 74,140,930 E448G possibly damaging Het
Scn10a T A 9: 119,666,063 M371L probably benign Het
Sgta T C 10: 81,048,908 D189G probably damaging Het
Spata31d1b A G 13: 59,716,277 H413R probably benign Het
Stau2 T C 1: 16,440,450 T95A probably damaging Het
Supt4a C T 11: 87,743,156 probably null Het
Tanc2 A G 11: 105,714,177 probably null Het
Tap2 T A 17: 34,212,354 V422D probably damaging Het
Tas2r138 A G 6: 40,612,865 L149P probably damaging Het
Tex15 T C 8: 33,572,617 S692P probably damaging Het
Tgm2 C T 2: 158,143,042 R48H probably damaging Het
Ticrr T A 7: 79,695,563 F1725L possibly damaging Het
Tnpo2 T A 8: 85,052,041 C672* probably null Het
Xkr9 A G 1: 13,700,784 I175V probably benign Het
Zfp428 T A 7: 24,515,378 S140T probably benign Het
Other mutations in Atp6v1e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Atp6v1e1 APN 6 120808411 missense possibly damaging 0.92
IGL01387:Atp6v1e1 APN 6 120795771 unclassified probably null
IGL01447:Atp6v1e1 APN 6 120795693 utr 3 prime probably benign
IGL02372:Atp6v1e1 APN 6 120801123 missense probably benign 0.00
R3801:Atp6v1e1 UTSW 6 120801059 missense probably benign 0.02
R4897:Atp6v1e1 UTSW 6 120804083 missense probably null 0.88
R5291:Atp6v1e1 UTSW 6 120818333 critical splice donor site probably null
R5690:Atp6v1e1 UTSW 6 120808356 splice site probably null
R6726:Atp6v1e1 UTSW 6 120804050 critical splice donor site probably null
R7080:Atp6v1e1 UTSW 6 120822389 intron probably benign
Z1176:Atp6v1e1 UTSW 6 120804119 missense probably benign 0.35
Z1176:Atp6v1e1 UTSW 6 120822449 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTTAAAAGACTCAGCACCAAGGCCA -3'
(R):5'- GGATGAGCCTCTGCCTCTTCCT -3'

Sequencing Primer
(F):5'- GGCCATTCCCATAACAAGCAG -3'
(R):5'- CTTCCTCCCATCTGTGTGTG -3'
Posted On2013-07-11