Incidental Mutation 'R0595:Tgm2'
ID189197
Institutional Source Beutler Lab
Gene Symbol Tgm2
Ensembl Gene ENSMUSG00000037820
Gene Nametransglutaminase 2, C polypeptide
SynonymstTG, protein-glutamine gamma-glutamyltransferase, TGase2, TG2, TG C, G[a]h, tTGas, tissue transglutaminase
MMRRC Submission 038785-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R0595 (G1)
Quality Score73
Status Validated
Chromosome2
Chromosomal Location158116402-158146436 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 158143042 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 48 (R48H)
Ref Sequence ENSEMBL: ENSMUSP00000133662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103122] [ENSMUST00000174718]
Predicted Effect probably damaging
Transcript: ENSMUST00000103122
AA Change: R48H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099411
Gene: ENSMUSG00000037820
AA Change: R48H

DomainStartEndE-ValueType
Pfam:Transglut_N 6 122 3.6e-34 PFAM
TGc 269 361 1.11e-38 SMART
Pfam:Transglut_C 473 572 5.7e-29 PFAM
Pfam:Transglut_C 586 685 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152690
Predicted Effect probably damaging
Transcript: ENSMUST00000174718
AA Change: R48H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133662
Gene: ENSMUSG00000037820
AA Change: R48H

DomainStartEndE-ValueType
Pfam:Transglut_N 5 124 1.9e-37 PFAM
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene acts as a monomer, is induced by retinoic acid, and appears to be involved in apoptosis. Finally, the encoded protein is the autoantigen implicated in celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous null mutation causes alterations in glucose and aerobic energy metabolism, tumor growth, and response to myocardial infarction, liver injury, and LPS-induced sepsis. A second null mutation confers resistance to renal injury, while a third one alters cell adhesion and T cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,740,417 D1093E probably damaging Het
Aldh2 G T 5: 121,573,500 A276D probably damaging Het
Aldh2 C T 5: 121,573,501 A276T probably damaging Het
Aldh7a1 C T 18: 56,546,893 probably benign Het
Ano1 C T 7: 144,590,153 R964H possibly damaging Het
Apob G A 12: 8,008,369 V2251I probably benign Het
Atp6v1e1 A G 6: 120,801,130 V148A probably benign Het
Bbs9 T A 9: 22,496,815 H73Q probably benign Het
Brca1 A G 11: 101,524,887 V807A probably benign Het
Cacna1b C T 2: 24,649,989 probably benign Het
Cadps2 A T 6: 23,321,704 probably null Het
Cep152 T C 2: 125,595,063 Q519R probably damaging Het
Cep295 A C 9: 15,332,191 Y1608* probably null Het
Cfap54 T C 10: 92,884,736 I2619V unknown Het
Dnajb9 A G 12: 44,208,284 V7A probably benign Het
Ep400 T C 5: 110,703,542 K1358R unknown Het
Fbxw7 C A 3: 84,977,367 probably null Het
Fsip2 T C 2: 82,946,952 Y108H probably damaging Het
Ggt6 T A 11: 72,437,667 L331Q probably damaging Het
Ifitm1 T A 7: 140,968,329 I25N possibly damaging Het
Krt75 C T 15: 101,568,354 E367K probably damaging Het
Lifr A G 15: 7,177,469 Y487C probably damaging Het
Map3k6 G T 4: 133,241,263 G59W probably damaging Het
Mme A G 3: 63,328,181 T129A probably benign Het
Mmp10 G A 9: 7,508,198 E442K probably benign Het
Myh13 T C 11: 67,344,846 S646P probably benign Het
Nbea A T 3: 55,628,496 I2889N probably benign Het
Nlrp4d T A 7: 10,381,045 K581N probably benign Het
Nr3c2 C T 8: 76,909,604 P445S possibly damaging Het
Olfr487 A T 7: 108,211,661 N289K probably damaging Het
Pck1 T A 2: 173,157,029 V360E probably damaging Het
Plekha7 T C 7: 116,144,968 D766G probably damaging Het
Prag1 A G 8: 36,147,002 N1236S probably damaging Het
Prkdc A C 16: 15,808,088 Q3326P probably damaging Het
Prrc2b T C 2: 32,183,177 M57T probably damaging Het
Rb1 A T 14: 73,273,680 F330I probably damaging Het
Rufy4 A G 1: 74,140,930 E448G possibly damaging Het
Scn10a T A 9: 119,666,063 M371L probably benign Het
Sgta T C 10: 81,048,908 D189G probably damaging Het
Spata31d1b A G 13: 59,716,277 H413R probably benign Het
Stau2 T C 1: 16,440,450 T95A probably damaging Het
Supt4a C T 11: 87,743,156 probably null Het
Tanc2 A G 11: 105,714,177 probably null Het
Tap2 T A 17: 34,212,354 V422D probably damaging Het
Tas2r138 A G 6: 40,612,865 L149P probably damaging Het
Tex15 T C 8: 33,572,617 S692P probably damaging Het
Ticrr T A 7: 79,695,563 F1725L possibly damaging Het
Tnpo2 T A 8: 85,052,041 C672* probably null Het
Xkr9 A G 1: 13,700,784 I175V probably benign Het
Zfp428 T A 7: 24,515,378 S140T probably benign Het
Other mutations in Tgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Tgm2 APN 2 158124131 missense probably benign
IGL03110:Tgm2 APN 2 158131490 nonsense probably null
IGL03397:Tgm2 APN 2 158120258 missense probably damaging 1.00
R0786:Tgm2 UTSW 2 158124381 missense probably damaging 1.00
R1019:Tgm2 UTSW 2 158124154 nonsense probably null
R1395:Tgm2 UTSW 2 158124252 missense probably benign 0.01
R1732:Tgm2 UTSW 2 158134357 missense probably damaging 1.00
R1776:Tgm2 UTSW 2 158131459 missense probably benign 0.00
R1863:Tgm2 UTSW 2 158124219 missense probably damaging 1.00
R2863:Tgm2 UTSW 2 158143099 missense probably benign 0.01
R3036:Tgm2 UTSW 2 158124247 missense probably benign 0.00
R4200:Tgm2 UTSW 2 158132490 missense probably benign
R4370:Tgm2 UTSW 2 158124301 nonsense probably null
R4612:Tgm2 UTSW 2 158124204 missense probably benign 0.16
R5100:Tgm2 UTSW 2 158127164 missense probably benign 0.33
R5213:Tgm2 UTSW 2 158143060 missense possibly damaging 0.88
R5253:Tgm2 UTSW 2 158129438 missense probably damaging 1.00
R5585:Tgm2 UTSW 2 158131455 nonsense probably null
R5593:Tgm2 UTSW 2 158127342 missense probably damaging 1.00
R5616:Tgm2 UTSW 2 158128720 missense probably damaging 1.00
R5796:Tgm2 UTSW 2 158118904 missense probably benign 0.00
R5821:Tgm2 UTSW 2 158143054 missense possibly damaging 0.81
R5842:Tgm2 UTSW 2 158143081 missense probably damaging 1.00
R6317:Tgm2 UTSW 2 158124150 missense probably benign 0.18
R6610:Tgm2 UTSW 2 158143100 nonsense probably null
R7134:Tgm2 UTSW 2 158138892 missense probably benign
R7151:Tgm2 UTSW 2 158129395 missense possibly damaging 0.95
R7268:Tgm2 UTSW 2 158120268 nonsense probably null
R7719:Tgm2 UTSW 2 158143118 missense probably damaging 1.00
X0058:Tgm2 UTSW 2 158124147 missense probably benign 0.01
X0067:Tgm2 UTSW 2 158118845 critical splice donor site probably null
Z1177:Tgm2 UTSW 2 158117899 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGAAAGCAGCGACCCAGTACAC -3'
(R):5'- GGATTGTATCACCTGAGACCACAGC -3'

Sequencing Primer
(F):5'- ccattctgaaactcagtttctcatc -3'
(R):5'- TGAGACCACAGCTTGCTGAG -3'
Posted On2014-05-13