Incidental Mutation 'R0595:Lifr'
ID 55084
Institutional Source Beutler Lab
Gene Symbol Lifr
Ensembl Gene ENSMUSG00000054263
Gene Name LIF receptor alpha
Synonyms soluble differentiation-stimulating factor receptor, A230075M04Rik
MMRRC Submission 038785-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0595 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 7120095-7226970 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7206950 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 487 (Y487C)
Ref Sequence ENSEMBL: ENSMUSP00000154181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]
AlphaFold P42703
Predicted Effect probably damaging
Transcript: ENSMUST00000067190
AA Change: Y487C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: Y487C

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164529
AA Change: Y487C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263
AA Change: Y487C

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 4e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171588
AA Change: Y487C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: Y487C

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226471
AA Change: Y487C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000226934
AA Change: Y487C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227727
AA Change: Y487C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.5443 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,790,417 (GRCm39) D1093E probably damaging Het
Aldh2 G T 5: 121,711,563 (GRCm39) A276D probably damaging Het
Aldh2 C T 5: 121,711,564 (GRCm39) A276T probably damaging Het
Aldh7a1 C T 18: 56,679,965 (GRCm39) probably benign Het
Ano1 C T 7: 144,143,890 (GRCm39) R964H possibly damaging Het
Apob G A 12: 8,058,369 (GRCm39) V2251I probably benign Het
Atp6v1e1 A G 6: 120,778,091 (GRCm39) V148A probably benign Het
Bbs9 T A 9: 22,408,111 (GRCm39) H73Q probably benign Het
Brca1 A G 11: 101,415,713 (GRCm39) V807A probably benign Het
Cacna1b C T 2: 24,540,001 (GRCm39) probably benign Het
Cadps2 A T 6: 23,321,703 (GRCm39) probably null Het
Cep152 T C 2: 125,436,983 (GRCm39) Q519R probably damaging Het
Cep295 A C 9: 15,243,487 (GRCm39) Y1608* probably null Het
Cfap54 T C 10: 92,720,598 (GRCm39) I2619V unknown Het
Dnajb9 A G 12: 44,255,067 (GRCm39) V7A probably benign Het
Ep400 T C 5: 110,851,408 (GRCm39) K1358R unknown Het
Fbxw7 C A 3: 84,884,674 (GRCm39) probably null Het
Fsip2 T C 2: 82,777,296 (GRCm39) Y108H probably damaging Het
Ggt6 T A 11: 72,328,493 (GRCm39) L331Q probably damaging Het
Ifitm1 T A 7: 140,548,242 (GRCm39) I25N possibly damaging Het
Krt75 C T 15: 101,476,789 (GRCm39) E367K probably damaging Het
Map3k6 G T 4: 132,968,574 (GRCm39) G59W probably damaging Het
Mme A G 3: 63,235,602 (GRCm39) T129A probably benign Het
Mmp10 G A 9: 7,508,199 (GRCm39) E442K probably benign Het
Myh13 T C 11: 67,235,672 (GRCm39) S646P probably benign Het
Nbea A T 3: 55,535,917 (GRCm39) I2889N probably benign Het
Nlrp4d T A 7: 10,114,972 (GRCm39) K581N probably benign Het
Nr3c2 C T 8: 77,636,233 (GRCm39) P445S possibly damaging Het
Or5p63 A T 7: 107,810,868 (GRCm39) N289K probably damaging Het
Pck1 T A 2: 172,998,822 (GRCm39) V360E probably damaging Het
Plekha7 T C 7: 115,744,203 (GRCm39) D766G probably damaging Het
Prag1 A G 8: 36,614,156 (GRCm39) N1236S probably damaging Het
Prkdc A C 16: 15,625,952 (GRCm39) Q3326P probably damaging Het
Prrc2b T C 2: 32,073,189 (GRCm39) M57T probably damaging Het
Rb1 A T 14: 73,511,120 (GRCm39) F330I probably damaging Het
Rufy4 A G 1: 74,180,089 (GRCm39) E448G possibly damaging Het
Scn10a T A 9: 119,495,129 (GRCm39) M371L probably benign Het
Sgta T C 10: 80,884,742 (GRCm39) D189G probably damaging Het
Spata31d1b A G 13: 59,864,091 (GRCm39) H413R probably benign Het
Stau2 T C 1: 16,510,674 (GRCm39) T95A probably damaging Het
Supt4a C T 11: 87,633,982 (GRCm39) probably null Het
Tanc2 A G 11: 105,605,003 (GRCm39) probably null Het
Tap2 T A 17: 34,431,328 (GRCm39) V422D probably damaging Het
Tas2r138 A G 6: 40,589,799 (GRCm39) L149P probably damaging Het
Tex15 T C 8: 34,062,645 (GRCm39) S692P probably damaging Het
Tgm2 C T 2: 157,984,962 (GRCm39) R48H probably damaging Het
Ticrr T A 7: 79,345,311 (GRCm39) F1725L possibly damaging Het
Tnpo2 T A 8: 85,778,670 (GRCm39) C672* probably null Het
Xkr9 A G 1: 13,771,008 (GRCm39) I175V probably benign Het
Zfp428 T A 7: 24,214,803 (GRCm39) S140T probably benign Het
Other mutations in Lifr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Lifr APN 15 7,215,220 (GRCm39) splice site probably null
IGL01470:Lifr APN 15 7,205,147 (GRCm39) nonsense probably null
IGL01489:Lifr APN 15 7,205,037 (GRCm39) splice site probably benign
IGL01619:Lifr APN 15 7,220,643 (GRCm39) missense probably damaging 1.00
IGL01636:Lifr APN 15 7,208,499 (GRCm39) splice site probably benign
IGL01943:Lifr APN 15 7,217,630 (GRCm39) missense probably damaging 1.00
IGL02253:Lifr APN 15 7,220,085 (GRCm39) missense probably damaging 1.00
IGL02355:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02362:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02450:Lifr APN 15 7,220,246 (GRCm39) missense probably damaging 1.00
IGL02477:Lifr APN 15 7,216,404 (GRCm39) missense probably damaging 1.00
IGL02503:Lifr APN 15 7,215,104 (GRCm39) missense probably damaging 1.00
IGL02571:Lifr APN 15 7,219,592 (GRCm39) unclassified probably benign
IGL03340:Lifr APN 15 7,207,417 (GRCm39) missense probably benign 0.02
N/A - 535:Lifr UTSW 15 7,216,434 (GRCm39) missense possibly damaging 0.80
R0012:Lifr UTSW 15 7,205,089 (GRCm39) missense possibly damaging 0.78
R0015:Lifr UTSW 15 7,217,667 (GRCm39) splice site probably null
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0305:Lifr UTSW 15 7,206,982 (GRCm39) missense probably damaging 0.99
R0416:Lifr UTSW 15 7,196,395 (GRCm39) missense probably damaging 1.00
R0440:Lifr UTSW 15 7,186,672 (GRCm39) nonsense probably null
R0519:Lifr UTSW 15 7,207,061 (GRCm39) missense probably damaging 1.00
R0601:Lifr UTSW 15 7,198,753 (GRCm39) splice site probably null
R0780:Lifr UTSW 15 7,206,947 (GRCm39) missense probably benign 0.00
R0790:Lifr UTSW 15 7,215,196 (GRCm39) missense probably benign 0.13
R1376:Lifr UTSW 15 7,214,245 (GRCm39) missense probably benign 0.04
R1376:Lifr UTSW 15 7,214,245 (GRCm39) missense probably benign 0.04
R1400:Lifr UTSW 15 7,220,346 (GRCm39) missense probably benign 0.04
R1498:Lifr UTSW 15 7,220,099 (GRCm39) missense probably damaging 0.99
R1785:Lifr UTSW 15 7,211,337 (GRCm39) missense possibly damaging 0.89
R1786:Lifr UTSW 15 7,211,337 (GRCm39) missense possibly damaging 0.89
R1906:Lifr UTSW 15 7,217,612 (GRCm39) missense probably damaging 0.98
R2099:Lifr UTSW 15 7,186,732 (GRCm39) missense probably benign
R2102:Lifr UTSW 15 7,216,404 (GRCm39) missense probably damaging 1.00
R2136:Lifr UTSW 15 7,211,338 (GRCm39) missense possibly damaging 0.89
R2511:Lifr UTSW 15 7,196,397 (GRCm39) missense probably benign
R4375:Lifr UTSW 15 7,196,379 (GRCm39) missense probably benign
R4883:Lifr UTSW 15 7,215,106 (GRCm39) missense possibly damaging 0.94
R5681:Lifr UTSW 15 7,220,565 (GRCm39) missense probably damaging 1.00
R5689:Lifr UTSW 15 7,214,285 (GRCm39) missense probably damaging 1.00
R5693:Lifr UTSW 15 7,205,041 (GRCm39) missense probably damaging 1.00
R5902:Lifr UTSW 15 7,220,231 (GRCm39) missense probably benign
R5918:Lifr UTSW 15 7,188,897 (GRCm39) missense probably benign 0.00
R5924:Lifr UTSW 15 7,202,453 (GRCm39) missense probably benign 0.28
R6037:Lifr UTSW 15 7,216,424 (GRCm39) missense probably damaging 1.00
R6037:Lifr UTSW 15 7,216,424 (GRCm39) missense probably damaging 1.00
R6289:Lifr UTSW 15 7,196,391 (GRCm39) missense probably benign 0.00
R6339:Lifr UTSW 15 7,196,530 (GRCm39) missense probably benign 0.01
R6860:Lifr UTSW 15 7,202,418 (GRCm39) missense probably benign 0.02
R7106:Lifr UTSW 15 7,202,405 (GRCm39) missense probably benign 0.02
R7107:Lifr UTSW 15 7,208,421 (GRCm39) missense possibly damaging 0.88
R7274:Lifr UTSW 15 7,196,540 (GRCm39) critical splice donor site probably null
R7625:Lifr UTSW 15 7,198,723 (GRCm39) missense probably damaging 0.99
R7631:Lifr UTSW 15 7,214,258 (GRCm39) missense probably damaging 1.00
R7958:Lifr UTSW 15 7,211,478 (GRCm39) missense possibly damaging 0.62
R7991:Lifr UTSW 15 7,202,963 (GRCm39) missense possibly damaging 0.79
R8175:Lifr UTSW 15 7,216,496 (GRCm39) missense probably damaging 1.00
R8427:Lifr UTSW 15 7,220,462 (GRCm39) missense probably benign 0.01
R9274:Lifr UTSW 15 7,217,591 (GRCm39) missense probably damaging 0.98
R9311:Lifr UTSW 15 7,208,418 (GRCm39) missense possibly damaging 0.47
R9365:Lifr UTSW 15 7,198,521 (GRCm39) missense probably damaging 1.00
R9509:Lifr UTSW 15 7,188,955 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAATCGCAAACTAGTATGACATCCA -3'
(R):5'- GTAAGAGAGATGACCCTCAAGGCCA -3'

Sequencing Primer
(F):5'- CGCAAACTAGTATGACATCCATTTGG -3'
(R):5'- TCAAGGCCATGCAAGTGTTC -3'
Posted On 2013-07-11