Incidental Mutation 'R7120:Itgad'
ID551933
Institutional Source Beutler Lab
Gene Symbol Itgad
Ensembl Gene ENSMUSG00000070369
Gene Nameintegrin, alpha D
SynonymsCd11d
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7120 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location128154376-128223816 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 128173974 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000033051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033051] [ENSMUST00000106237] [ENSMUST00000177111]
Predicted Effect probably null
Transcript: ENSMUST00000033051
AA Change: M1K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000033051
Gene: ENSMUSG00000070369
AA Change: M1K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 376 1.24e-36 SMART
Blast:VWA 405 436 1e-9 BLAST
Int_alpha 443 492 3.67e-3 SMART
Int_alpha 496 553 1.03e-6 SMART
Int_alpha 559 615 1.73e-13 SMART
Int_alpha 622 676 1.69e-2 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Pfam:Integrin_alpha 1165 1179 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106237
SMART Domains Protein: ENSMUSP00000101844
Gene: ENSMUSG00000070369

DomainStartEndE-ValueType
Int_alpha 40 90 1.35e1 SMART
VWA 157 342 1.31e-44 SMART
Blast:VWA 371 402 9e-10 BLAST
Int_alpha 409 458 3.67e-3 SMART
Int_alpha 462 519 1.03e-6 SMART
Int_alpha 525 581 1.73e-13 SMART
Int_alpha 588 642 1.69e-2 SMART
transmembrane domain 1108 1130 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 4.3e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177111
AA Change: M1K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135572
Gene: ENSMUSG00000070369
AA Change: M1K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 340 1.31e-44 SMART
Blast:VWA 369 400 9e-10 BLAST
Int_alpha 407 456 3.67e-3 SMART
Int_alpha 460 517 1.03e-6 SMART
Int_alpha 523 579 1.73e-13 SMART
Int_alpha 586 640 1.69e-2 SMART
transmembrane domain 1106 1128 N/A INTRINSIC
Pfam:Integrin_alpha 1129 1143 5.4e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the beta-2 integrin family of membrane glycoproteins, which are are composed of non-covalently linked alpha and beta subunits to form a heterodimer. It encodes the alpha subunit of the cell surface heterodimers and is involved in the activation and adhesion functions of leukocytes. The gene is located about 11kb downstream of the integrin subunit alpha X gene, another member of the integrin family. It is expressed in the tissue and circulating myeloid leukocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice exhibit a reduced staphylococcal enterotoxin-induced T cell response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik A T 3: 36,481,867 Q94L unknown Het
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Actr3 A C 1: 125,403,432 Y273* probably null Het
Aoc1 T A 6: 48,906,597 I469N probably damaging Het
Arhgef28 A T 13: 97,944,539 L1270Q probably damaging Het
Atp2c1 G A 9: 105,420,186 Q780* probably null Het
Bbs10 T C 10: 111,299,449 V141A possibly damaging Het
Bivm A T 1: 44,126,446 T19S probably benign Het
Cacna1h T G 17: 25,391,507 H675P probably benign Het
Cadps T A 14: 12,439,919 L1204F probably damaging Het
Cald1 T C 6: 34,686,076 probably null Het
Calr A G 8: 84,842,828 M357T probably damaging Het
Ccni A T 5: 93,183,331 Y260* probably null Het
Csrnp3 C A 2: 66,023,010 T594K probably damaging Het
Dek A T 13: 47,100,183 M152K unknown Het
Depdc1b T C 13: 108,362,247 W155R probably benign Het
Ehd1 A G 19: 6,297,561 K315R probably benign Het
Epn3 C A 11: 94,492,428 R323S probably benign Het
Fam57b T C 7: 126,829,333 L221P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxo10 T A 4: 45,040,533 K891* probably null Het
Fras1 G T 5: 96,752,960 G3013* probably null Het
Gbp2b A G 3: 142,606,746 T297A probably benign Het
Gbp7 T C 3: 142,543,973 S402P probably damaging Het
Gclc T C 9: 77,786,750 Y329H probably damaging Het
Gfpt1 A G 6: 87,087,393 H655R probably benign Het
Gm4787 C A 12: 81,378,486 M299I probably benign Het
Grb7 C A 11: 98,454,991 R532S probably benign Het
Hmcn1 A T 1: 150,700,541 I2066N probably damaging Het
Hnrnpll T C 17: 80,034,057 T518A probably benign Het
Hps3 G A 3: 20,011,541 R712W probably damaging Het
Hspd1 A G 1: 55,079,229 V406A probably benign Het
Igkv2-112 T C 6: 68,220,526 F61L probably benign Het
Iqcf5 G A 9: 106,515,796 R84H probably damaging Het
Kmt2d A G 15: 98,861,065 S1292P unknown Het
Macc1 C A 12: 119,445,745 Q83K possibly damaging Het
Map3k4 G T 17: 12,271,467 A359E probably damaging Het
Mfap3 T A 11: 57,528,217 C68S probably damaging Het
Mipep C T 14: 60,875,247 R660C possibly damaging Het
Morc2b A T 17: 33,135,813 L995Q probably damaging Het
Mrc1 A G 2: 14,308,697 N913S probably damaging Het
N4bp1 C A 8: 86,860,867 C481F probably benign Het
Nae1 A G 8: 104,526,278 probably null Het
Nup214 T A 2: 32,051,042 V29E probably benign Het
Olfr251 T C 9: 38,378,649 L250P probably damaging Het
Olfr390 A T 11: 73,787,114 M59L probably damaging Het
Orai1 A G 5: 123,029,472 E236G possibly damaging Het
P2rx7 A G 5: 122,681,294 Y593C probably benign Het
Pcbp2 A G 15: 102,474,678 D77G possibly damaging Het
Pcdha8 G A 18: 36,993,787 V441M possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plaa A G 4: 94,582,682 S406P possibly damaging Het
Plekhh1 C A 12: 79,070,939 P903Q probably benign Het
Plekhh3 T C 11: 101,168,238 E92G probably damaging Het
Ptpn9 T C 9: 57,059,882 F463S probably damaging Het
Ptprn2 A C 12: 116,872,056 E337A probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Samd3 C T 10: 26,230,966 T73M possibly damaging Het
Sfxn4 T A 19: 60,852,039 K173* probably null Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Son T G 16: 91,670,526 N2258K unknown Het
Sspo A T 6: 48,465,571 H2000L probably benign Het
Syne1 C T 10: 5,293,971 S2731N probably benign Het
Syt6 T C 3: 103,587,357 Y213H probably damaging Het
Tkt A G 14: 30,559,822 N99S probably benign Het
Tmem258 G A 19: 10,204,238 probably benign Het
Tnks1bp1 T C 2: 85,072,097 S1702P probably damaging Het
Tpte A G 8: 22,327,673 D225G probably damaging Het
Trak1 T A 9: 121,460,498 F625L probably benign Het
Ttc33 G T 15: 5,212,007 C77F probably benign Het
Ugt1a2 A G 1: 88,200,800 H55R probably damaging Het
Vmn1r169 G T 7: 23,578,019 V279L probably benign Het
Vmn2r25 T C 6: 123,828,435 K488E possibly damaging Het
Vmn2r8 A T 5: 108,808,638 D39E possibly damaging Het
Other mutations in Itgad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Itgad APN 7 128203850 missense probably damaging 0.99
IGL02036:Itgad APN 7 128189821 missense possibly damaging 0.49
IGL02589:Itgad APN 7 128181711 missense probably damaging 1.00
IGL02648:Itgad APN 7 128183374 intron probably benign
IGL02735:Itgad APN 7 128193716 missense probably damaging 1.00
IGL03088:Itgad APN 7 128203032 missense probably benign 0.01
IGL03110:Itgad APN 7 128185985 missense probably damaging 1.00
BB007:Itgad UTSW 7 128183108 missense probably benign 0.01
BB017:Itgad UTSW 7 128183108 missense probably benign 0.01
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0184:Itgad UTSW 7 128189231 missense probably benign 0.02
R0211:Itgad UTSW 7 128204641 missense probably damaging 1.00
R0211:Itgad UTSW 7 128204641 missense probably damaging 1.00
R0282:Itgad UTSW 7 128189978 splice site probably benign
R0326:Itgad UTSW 7 128198378 missense probably benign 0.00
R0646:Itgad UTSW 7 128174004 missense possibly damaging 0.89
R0947:Itgad UTSW 7 128175693 missense probably benign 0.08
R1439:Itgad UTSW 7 128183006 missense probably benign 0.44
R1454:Itgad UTSW 7 128192137 missense probably benign 0.02
R1503:Itgad UTSW 7 128198121 missense probably benign 0.00
R1531:Itgad UTSW 7 128178370 missense probably benign 0.00
R1572:Itgad UTSW 7 128203234 missense probably damaging 1.00
R1602:Itgad UTSW 7 128190939 missense probably damaging 1.00
R1732:Itgad UTSW 7 128205107 missense probably benign
R2278:Itgad UTSW 7 128205170 missense possibly damaging 0.93
R2851:Itgad UTSW 7 128204560 missense probably benign 0.01
R3029:Itgad UTSW 7 128178371 missense possibly damaging 0.85
R3080:Itgad UTSW 7 128185787 missense possibly damaging 0.48
R3150:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3176:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3177:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3276:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3277:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3833:Itgad UTSW 7 128186233 missense probably damaging 1.00
R4541:Itgad UTSW 7 128198115 missense probably benign 0.13
R4649:Itgad UTSW 7 128189531 missense probably benign 0.01
R4753:Itgad UTSW 7 128223703 makesense probably null
R4852:Itgad UTSW 7 128198530 missense probably damaging 1.00
R4931:Itgad UTSW 7 128204625 missense probably damaging 1.00
R4970:Itgad UTSW 7 128189843 missense possibly damaging 0.70
R5116:Itgad UTSW 7 128203893 missense probably damaging 1.00
R5183:Itgad UTSW 7 128198223 critical splice donor site probably null
R5233:Itgad UTSW 7 128193428 splice site probably null
R5334:Itgad UTSW 7 128189286 missense probably damaging 0.99
R5731:Itgad UTSW 7 128198554 missense probably benign 0.19
R5760:Itgad UTSW 7 128203365 missense probably benign 0.02
R5896:Itgad UTSW 7 128174016 missense probably benign 0.34
R5955:Itgad UTSW 7 128189481 missense probably benign 0.00
R6247:Itgad UTSW 7 128185787 missense possibly damaging 0.48
R6659:Itgad UTSW 7 128185948 missense probably damaging 1.00
R7027:Itgad UTSW 7 128182989 missense probably damaging 1.00
R7104:Itgad UTSW 7 128198378 missense probably benign 0.00
R7272:Itgad UTSW 7 128205073 missense probably damaging 1.00
R7303:Itgad UTSW 7 128190179 missense probably benign
R7324:Itgad UTSW 7 128189807 missense probably damaging 1.00
R7565:Itgad UTSW 7 128183015 missense probably damaging 0.98
R7566:Itgad UTSW 7 128192107 missense probably benign 0.40
R7930:Itgad UTSW 7 128183108 missense probably benign 0.01
RF019:Itgad UTSW 7 128192208 missense probably benign 0.08
Z1176:Itgad UTSW 7 128190087 missense probably damaging 1.00
Z1177:Itgad UTSW 7 128189501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGCTTCTAGTGGGCAAC -3'
(R):5'- TGAAAGCAAGTTACCTATCCTCCC -3'

Sequencing Primer
(F):5'- CTTCTAGTGGGCAACGAGAG -3'
(R):5'- AGTTACCTATCCTCCCTTTGATTCAG -3'
Posted On2019-05-15