Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Itgad'

169450

Institutional Source

Beutler Lab

Gene Symbol

Itgad

Ensembl Gene

ENSMUSG00000070369

Gene Name

integrin, alpha D

Synonyms

Cd11d

MMRRC Submission

039553-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R1503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128154376-128223816 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128198121 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 846 (Y846C)

Ref Sequence

ENSEMBL: ENSMUSP00000101844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033051] [ENSMUST00000106237] [ENSMUST00000177111]

AlphaFold

Q3V0T4

Predicted Effect

probably benign
Transcript: ENSMUST00000033051
AA Change: Y880C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000033051
Gene: ENSMUSG00000070369
AA Change: Y880C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Int_alpha	38	88	1.35e1	SMART
VWA	155	376	1.24e-36	SMART
Blast:VWA	405	436	1e-9	BLAST
Int_alpha	443	492	3.67e-3	SMART
Int_alpha	496	553	1.03e-6	SMART
Int_alpha	559	615	1.73e-13	SMART
Int_alpha	622	676	1.69e-2	SMART
transmembrane domain	1142	1164	N/A	INTRINSIC
Pfam:Integrin_alpha	1165	1179	1.3e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106237
AA Change: Y846C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000101844
Gene: ENSMUSG00000070369
AA Change: Y846C

Domain	Start	End	E-Value	Type
Int_alpha	40	90	1.35e1	SMART
VWA	157	342	1.31e-44	SMART
Blast:VWA	371	402	9e-10	BLAST
Int_alpha	409	458	3.67e-3	SMART
Int_alpha	462	519	1.03e-6	SMART
Int_alpha	525	581	1.73e-13	SMART
Int_alpha	588	642	1.69e-2	SMART
transmembrane domain	1108	1130	N/A	INTRINSIC
Pfam:Integrin_alpha	1131	1145	4.3e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177111
AA Change: Y844C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135572
Gene: ENSMUSG00000070369
AA Change: Y844C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Int_alpha	38	88	1.35e1	SMART
VWA	155	340	1.31e-44	SMART
Blast:VWA	369	400	9e-10	BLAST
Int_alpha	407	456	3.67e-3	SMART
Int_alpha	460	517	1.03e-6	SMART
Int_alpha	523	579	1.73e-13	SMART
Int_alpha	586	640	1.69e-2	SMART
transmembrane domain	1106	1128	N/A	INTRINSIC
Pfam:Integrin_alpha	1129	1143	5.4e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205522

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205646

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the beta-2 integrin family of membrane glycoproteins, which are are composed of non-covalently linked alpha and beta subunits to form a heterodimer. It encodes the alpha subunit of the cell surface heterodimers and is involved in the activation and adhesion functions of leukocytes. The gene is located about 11kb downstream of the integrin subunit alpha X gene, another member of the integrin family. It is expressed in the tissue and circulating myeloid leukocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice exhibit a reduced staphylococcal enterotoxin-induced T cell response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atf7ip	G	T	6: 136,606,867	V1299L	probably damaging	Het
Atp12a	A	T	14: 56,373,424	N342Y	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Cacna1a	A	G	8: 84,601,946	D1624G	probably benign	Het
Carmil3	A	C	14: 55,498,280	N563T	probably damaging	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Cdan1	A	T	2: 120,729,575	H369Q	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Dnhd1	T	G	7: 105,693,660	S1404A	possibly damaging	Het
Drosha	T	A	15: 12,848,073	C484S	probably benign	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Gphn	A	G	12: 78,504,629	I248V	possibly damaging	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Ints8	A	T	4: 11,245,842	L212Q	probably damaging	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Nxf1	T	A	19: 8,762,436	F51L	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Skp2	C	A	15: 9,127,911	V88F	probably damaging	Het
Slc25a16	T	C	10: 62,928,376	Y71H	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Wdhd1	A	T	14: 47,247,400	D885E	probably benign	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Itgad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Itgad	APN	7	128203850	missense	probably damaging	0.99
IGL02036:Itgad	APN	7	128189821	missense	possibly damaging	0.49
IGL02589:Itgad	APN	7	128181711	missense	probably damaging	1.00
IGL02648:Itgad	APN	7	128183374	intron	probably benign
IGL02735:Itgad	APN	7	128193716	missense	probably damaging	1.00
IGL03088:Itgad	APN	7	128203032	missense	probably benign	0.01
IGL03110:Itgad	APN	7	128185985	missense	probably damaging	1.00
BB007:Itgad	UTSW	7	128183108	missense	probably benign	0.01
BB017:Itgad	UTSW	7	128183108	missense	probably benign	0.01
R0060:Itgad	UTSW	7	128202986	missense	probably damaging	1.00
R0060:Itgad	UTSW	7	128202986	missense	probably damaging	1.00
R0184:Itgad	UTSW	7	128189231	missense	probably benign	0.02
R0211:Itgad	UTSW	7	128204641	missense	probably damaging	1.00
R0211:Itgad	UTSW	7	128204641	missense	probably damaging	1.00
R0282:Itgad	UTSW	7	128189978	splice site	probably benign
R0326:Itgad	UTSW	7	128198378	missense	probably benign	0.00
R0646:Itgad	UTSW	7	128174004	missense	possibly damaging	0.89
R0947:Itgad	UTSW	7	128175693	missense	probably benign	0.08
R1439:Itgad	UTSW	7	128183006	missense	probably benign	0.44
R1454:Itgad	UTSW	7	128192137	missense	probably benign	0.02
R1531:Itgad	UTSW	7	128178370	missense	probably benign	0.00
R1572:Itgad	UTSW	7	128203234	missense	probably damaging	1.00
R1602:Itgad	UTSW	7	128190939	missense	probably damaging	1.00
R1732:Itgad	UTSW	7	128205107	missense	probably benign
R2278:Itgad	UTSW	7	128205170	missense	possibly damaging	0.93
R2851:Itgad	UTSW	7	128204560	missense	probably benign	0.01
R3029:Itgad	UTSW	7	128178371	missense	possibly damaging	0.85
R3080:Itgad	UTSW	7	128185787	missense	possibly damaging	0.48
R3150:Itgad	UTSW	7	128190981	missense	possibly damaging	0.64
R3176:Itgad	UTSW	7	128190981	missense	possibly damaging	0.64
R3177:Itgad	UTSW	7	128190981	missense	possibly damaging	0.64
R3276:Itgad	UTSW	7	128190981	missense	possibly damaging	0.64
R3277:Itgad	UTSW	7	128190981	missense	possibly damaging	0.64
R3833:Itgad	UTSW	7	128186233	missense	probably damaging	1.00
R4541:Itgad	UTSW	7	128198115	missense	probably benign	0.13
R4649:Itgad	UTSW	7	128189531	missense	probably benign	0.01
R4753:Itgad	UTSW	7	128223703	makesense	probably null
R4852:Itgad	UTSW	7	128198530	missense	probably damaging	1.00
R4931:Itgad	UTSW	7	128204625	missense	probably damaging	1.00
R4970:Itgad	UTSW	7	128189843	missense	possibly damaging	0.70
R5116:Itgad	UTSW	7	128203893	missense	probably damaging	1.00
R5183:Itgad	UTSW	7	128198223	critical splice donor site	probably null
R5233:Itgad	UTSW	7	128193428	splice site	probably null
R5334:Itgad	UTSW	7	128189286	missense	probably damaging	0.99
R5731:Itgad	UTSW	7	128198554	missense	probably benign	0.19
R5760:Itgad	UTSW	7	128203365	missense	probably benign	0.02
R5896:Itgad	UTSW	7	128174016	missense	probably benign	0.34
R5955:Itgad	UTSW	7	128189481	missense	probably benign	0.00
R6247:Itgad	UTSW	7	128185787	missense	possibly damaging	0.48
R6659:Itgad	UTSW	7	128185948	missense	probably damaging	1.00
R7027:Itgad	UTSW	7	128182989	missense	probably damaging	1.00
R7104:Itgad	UTSW	7	128198378	missense	probably benign	0.00
R7120:Itgad	UTSW	7	128173974	start codon destroyed	probably null	0.02
R7272:Itgad	UTSW	7	128205073	missense	probably damaging	1.00
R7303:Itgad	UTSW	7	128190179	missense	probably benign
R7324:Itgad	UTSW	7	128189807	missense	probably damaging	1.00
R7565:Itgad	UTSW	7	128183015	missense	probably damaging	0.98
R7566:Itgad	UTSW	7	128192107	missense	probably benign	0.40
R7930:Itgad	UTSW	7	128183108	missense	probably benign	0.01
R8550:Itgad	UTSW	7	128203892	missense	probably damaging	0.98
R8816:Itgad	UTSW	7	128198370	nonsense	probably null
R8849:Itgad	UTSW	7	128189985	splice site	probably benign
R8952:Itgad	UTSW	7	128190152	missense	probably damaging	1.00
R9345:Itgad	UTSW	7	128189307	missense	probably benign	0.02
R9354:Itgad	UTSW	7	128185974	missense	probably damaging	1.00
R9526:Itgad	UTSW	7	128178380	missense	probably benign	0.09
R9614:Itgad	UTSW	7	128203850	missense	probably damaging	0.99
R9623:Itgad	UTSW	7	128204551	missense	probably damaging	1.00
R9773:Itgad	UTSW	7	128190050	missense	probably damaging	0.97
RF019:Itgad	UTSW	7	128192208	missense	probably benign	0.08
Z1176:Itgad	UTSW	7	128190087	missense	probably damaging	1.00
Z1177:Itgad	UTSW	7	128189501	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTCGGTCATATGCCAGTCCTATC -3'
(R):5'- AGAAGCAACCTGTCTCCCAGGAAG -3'

Sequencing Primer
(F):5'- agccctcagtttgtgctc -3'
(R):5'- CCTTGTAGGAGACATCAAATGTG -3'

Posted On

2014-04-13