Incidental Mutation 'R1602:Itgad'
ID176205
Institutional Source Beutler Lab
Gene Symbol Itgad
Ensembl Gene ENSMUSG00000070369
Gene Nameintegrin, alpha D
SynonymsCd11d
MMRRC Submission 039639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1602 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128154376-128223816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128190939 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 637 (T637A)
Ref Sequence ENSEMBL: ENSMUSP00000033051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033051] [ENSMUST00000106237] [ENSMUST00000177111]
Predicted Effect probably damaging
Transcript: ENSMUST00000033051
AA Change: T637A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033051
Gene: ENSMUSG00000070369
AA Change: T637A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 376 1.24e-36 SMART
Blast:VWA 405 436 1e-9 BLAST
Int_alpha 443 492 3.67e-3 SMART
Int_alpha 496 553 1.03e-6 SMART
Int_alpha 559 615 1.73e-13 SMART
Int_alpha 622 676 1.69e-2 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Pfam:Integrin_alpha 1165 1179 1.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106237
AA Change: T603A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101844
Gene: ENSMUSG00000070369
AA Change: T603A

DomainStartEndE-ValueType
Int_alpha 40 90 1.35e1 SMART
VWA 157 342 1.31e-44 SMART
Blast:VWA 371 402 9e-10 BLAST
Int_alpha 409 458 3.67e-3 SMART
Int_alpha 462 519 1.03e-6 SMART
Int_alpha 525 581 1.73e-13 SMART
Int_alpha 588 642 1.69e-2 SMART
transmembrane domain 1108 1130 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 4.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177111
AA Change: T601A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135572
Gene: ENSMUSG00000070369
AA Change: T601A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 340 1.31e-44 SMART
Blast:VWA 369 400 9e-10 BLAST
Int_alpha 407 456 3.67e-3 SMART
Int_alpha 460 517 1.03e-6 SMART
Int_alpha 523 579 1.73e-13 SMART
Int_alpha 586 640 1.69e-2 SMART
transmembrane domain 1106 1128 N/A INTRINSIC
Pfam:Integrin_alpha 1129 1143 5.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205646
Meta Mutation Damage Score 0.5832 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the beta-2 integrin family of membrane glycoproteins, which are are composed of non-covalently linked alpha and beta subunits to form a heterodimer. It encodes the alpha subunit of the cell surface heterodimers and is involved in the activation and adhesion functions of leukocytes. The gene is located about 11kb downstream of the integrin subunit alpha X gene, another member of the integrin family. It is expressed in the tissue and circulating myeloid leukocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice exhibit a reduced staphylococcal enterotoxin-induced T cell response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Ccdc110 A G 8: 45,938,918 Y54C probably benign Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Diaph3 T A 14: 87,091,158 probably benign Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Elmod3 A G 6: 72,569,259 probably null Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Kank2 T C 9: 21,769,837 S799G probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Lig3 T C 11: 82,792,194 probably null Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Olfr32 A G 2: 90,139,055 F28S probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Pex6 G T 17: 46,712,137 R213L probably benign Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Pla2g12b T C 10: 59,421,553 probably null Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Ptpa G T 2: 30,437,590 A119S probably benign Het
Slfn3 A G 11: 83,212,715 I137M probably damaging Het
St6galnac1 A T 11: 116,769,287 S67T probably benign Het
Treml1 A G 17: 48,364,889 E137G probably damaging Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Vmn2r55 A T 7: 12,652,644 C470S probably damaging Het
Other mutations in Itgad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Itgad APN 7 128203850 missense probably damaging 0.99
IGL02036:Itgad APN 7 128189821 missense possibly damaging 0.49
IGL02589:Itgad APN 7 128181711 missense probably damaging 1.00
IGL02648:Itgad APN 7 128183374 intron probably benign
IGL02735:Itgad APN 7 128193716 missense probably damaging 1.00
IGL03088:Itgad APN 7 128203032 missense probably benign 0.01
IGL03110:Itgad APN 7 128185985 missense probably damaging 1.00
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0184:Itgad UTSW 7 128189231 missense probably benign 0.02
R0211:Itgad UTSW 7 128204641 missense probably damaging 1.00
R0211:Itgad UTSW 7 128204641 missense probably damaging 1.00
R0282:Itgad UTSW 7 128189978 splice site probably benign
R0326:Itgad UTSW 7 128198378 missense probably benign 0.00
R0646:Itgad UTSW 7 128174004 missense possibly damaging 0.89
R0947:Itgad UTSW 7 128175693 missense probably benign 0.08
R1439:Itgad UTSW 7 128183006 missense probably benign 0.44
R1454:Itgad UTSW 7 128192137 missense probably benign 0.02
R1503:Itgad UTSW 7 128198121 missense probably benign 0.00
R1531:Itgad UTSW 7 128178370 missense probably benign 0.00
R1572:Itgad UTSW 7 128203234 missense probably damaging 1.00
R1732:Itgad UTSW 7 128205107 missense probably benign
R2278:Itgad UTSW 7 128205170 missense possibly damaging 0.93
R2851:Itgad UTSW 7 128204560 missense probably benign 0.01
R3029:Itgad UTSW 7 128178371 missense possibly damaging 0.85
R3080:Itgad UTSW 7 128185787 missense possibly damaging 0.48
R3150:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3176:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3177:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3276:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3277:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3833:Itgad UTSW 7 128186233 missense probably damaging 1.00
R4541:Itgad UTSW 7 128198115 missense probably benign 0.13
R4649:Itgad UTSW 7 128189531 missense probably benign 0.01
R4753:Itgad UTSW 7 128223703 makesense probably null
R4852:Itgad UTSW 7 128198530 missense probably damaging 1.00
R4931:Itgad UTSW 7 128204625 missense probably damaging 1.00
R4970:Itgad UTSW 7 128189843 missense possibly damaging 0.70
R5116:Itgad UTSW 7 128203893 missense probably damaging 1.00
R5183:Itgad UTSW 7 128198223 critical splice donor site probably null
R5233:Itgad UTSW 7 128193428 splice site probably null
R5334:Itgad UTSW 7 128189286 missense probably damaging 0.99
R5731:Itgad UTSW 7 128198554 missense probably benign 0.19
R5760:Itgad UTSW 7 128203365 missense probably benign 0.02
R5896:Itgad UTSW 7 128174016 missense probably benign 0.34
R5955:Itgad UTSW 7 128189481 missense probably benign 0.00
R6247:Itgad UTSW 7 128185787 missense possibly damaging 0.48
R6659:Itgad UTSW 7 128185948 missense probably damaging 1.00
R7027:Itgad UTSW 7 128182989 missense probably damaging 1.00
R7104:Itgad UTSW 7 128198378 missense probably benign 0.00
R7120:Itgad UTSW 7 128173974 start codon destroyed probably null 0.02
R7272:Itgad UTSW 7 128205073 missense probably damaging 1.00
R7303:Itgad UTSW 7 128190179 missense probably benign
R7324:Itgad UTSW 7 128189807 missense probably damaging 1.00
R7565:Itgad UTSW 7 128183015 missense probably damaging 0.98
R7566:Itgad UTSW 7 128192107 missense probably benign 0.40
RF019:Itgad UTSW 7 128192208 missense probably benign 0.08
Z1176:Itgad UTSW 7 128190087 missense probably damaging 1.00
Z1177:Itgad UTSW 7 128189501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACTGGTCCCTCAGGACAAGCTG -3'
(R):5'- GGGCAAATCTAATGGAGATCCCCAC -3'

Sequencing Primer
(F):5'- AATCGTCTCCTAAGACCCCTC -3'
(R):5'- TAATGGAGATCCCCACTTTCAG -3'
Posted On2014-04-24