Incidental Mutation 'R7123:Myo5c'
ID552149
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7123 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75289223 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1317 (K1317R)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably benign
Transcript: ENSMUST00000036555
AA Change: K1317R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: K1317R

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216788
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik G A 13: 59,743,440 Q189* probably null Het
Abca17 A G 17: 24,265,975 I1521T probably damaging Het
Adgrv1 A T 13: 81,592,574 I145N probably damaging Het
Ago3 C A 4: 126,355,005 probably null Het
Agrn A T 4: 156,172,840 W1178R probably benign Het
Akap3 A T 6: 126,866,304 I629L probably benign Het
Aknad1 T G 3: 108,775,244 Y545* probably null Het
Anapc1 C A 2: 128,613,010 V1925F probably damaging Het
Barhl1 C T 2: 28,909,931 probably null Het
Cfap157 T C 2: 32,779,401 E294G probably damaging Het
Cfd G A 10: 79,892,497 G231S probably damaging Het
Csf2ra A G 19: 61,226,862 V105A probably damaging Het
Dhtkd1 A T 2: 5,917,780 W523R probably damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc22 A C 15: 99,101,204 Y90S possibly damaging Het
Ebna1bp2 A G 4: 118,625,575 K254E probably damaging Het
Gfpt1 A T 6: 87,056,186 D131V probably damaging Het
Gm5460 A G 14: 34,042,025 I21V unknown Het
Gm7030 A G 17: 36,127,794 I235T possibly damaging Het
Htr1d C T 4: 136,442,353 probably benign Het
Kndc1 G A 7: 139,936,836 E1570K probably damaging Het
Kntc1 T C 5: 123,781,726 Y887H probably damaging Het
Kti12 T C 4: 108,848,482 S198P probably benign Het
Mcmdc2 A T 1: 9,940,418 I604F unknown Het
Mmp8 A T 9: 7,563,195 D253V probably damaging Het
Muc4 T C 16: 32,750,691 S252P possibly damaging Het
Ncoa7 T C 10: 30,654,439 I749V probably benign Het
Nfrkb A G 9: 31,414,015 probably null Het
Obscn T C 11: 59,013,651 T7166A probably benign Het
Obsl1 A G 1: 75,489,669 S1472P probably damaging Het
Olfr128 T A 17: 37,923,676 L37M probably benign Het
Olfr379-ps1 T A 11: 73,433,710 D172V unknown Het
Orc1 A C 4: 108,588,687 M1L probably damaging Het
Pkd1 T A 17: 24,594,768 S4069T possibly damaging Het
Pus1 T C 5: 110,773,932 *442W probably null Het
Rgma A C 7: 73,409,391 D97A probably damaging Het
Ryr1 T C 7: 29,046,854 K3834E probably benign Het
Sars2 T C 7: 28,753,441 V475A probably benign Het
Scamp2 A T 9: 57,587,102 T253S probably benign Het
Skint9 C T 4: 112,390,977 W190* probably null Het
Sv2b C T 7: 75,117,702 V649I possibly damaging Het
Synpo2 A G 3: 123,113,186 V827A probably benign Het
Tiparp A T 3: 65,553,527 I646F probably damaging Het
Topaz1 G A 9: 122,748,415 G130D probably damaging Het
Trio TACCTTGTTACTGAGCCCTTCTCACCTTCACAGACACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC TACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC 15: 27,742,313 probably benign Het
Ttll7 C T 3: 146,913,296 P319S possibly damaging Het
Umodl1 T A 17: 30,982,344 F416I possibly damaging Het
Vmn2r104 T C 17: 20,040,826 D445G probably benign Het
Wnk2 A G 13: 49,081,986 V651A possibly damaging Het
Zbtb21 C T 16: 97,949,912 S1057N probably damaging Het
Zfp451 A T 1: 33,776,869 C667S probably damaging Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
PIT4431001:Myo5c UTSW 9 75252571 missense possibly damaging 0.75
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
R6996:Myo5c UTSW 9 75250464 missense probably benign 0.01
R7023:Myo5c UTSW 9 75301456 missense probably damaging 0.98
R7250:Myo5c UTSW 9 75262215 missense probably damaging 1.00
R7316:Myo5c UTSW 9 75269638 missense probably benign 0.00
R7340:Myo5c UTSW 9 75289141 missense probably benign
R7382:Myo5c UTSW 9 75304050 missense probably damaging 1.00
R7426:Myo5c UTSW 9 75251527 splice site probably null
R7788:Myo5c UTSW 9 75279345 missense probably damaging 0.98
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGGTGGGAACTGGACAG -3'
(R):5'- GGCTGAGTGTTTGTCATCACAAC -3'

Sequencing Primer
(F):5'- TGGACAGGCCACTTCCATCTG -3'
(R):5'- ACCACCTGCCTGAGATAAGG -3'
Posted On2019-05-15