Incidental Mutation 'R7129:Akt1'
ID552539
Institutional Source Beutler Lab
Gene Symbol Akt1
Ensembl Gene ENSMUSG00000001729
Gene Namethymoma viral proto-oncogene 1
SynonymsPKBalpha, PKB/Akt, Akt, PKB
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R7129 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location112653821-112674884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112659649 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 63 (M63K)
Ref Sequence ENSEMBL: ENSMUSP00000001780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001780] [ENSMUST00000128300] [ENSMUST00000130342] [ENSMUST00000144550]
Predicted Effect probably benign
Transcript: ENSMUST00000001780
AA Change: M63K

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000001780
Gene: ENSMUSG00000001729
AA Change: M63K

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
S_TKc 150 408 1.56e-107 SMART
S_TK_X 409 476 1.44e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128300
AA Change: M63K

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122222
Gene: ENSMUSG00000001729
AA Change: M63K

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Pfam:Pkinase 150 278 1e-31 PFAM
Pfam:Pkinase_Tyr 150 278 3.8e-13 PFAM
Pfam:Pkinase_Tyr 276 350 8.7e-6 PFAM
Pfam:Pkinase 277 365 5e-17 PFAM
S_TK_X 366 433 1.44e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130342
AA Change: M63K

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118190
Gene: ENSMUSG00000001729
AA Change: M63K

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144550
AA Change: M63K

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123689
Gene: ENSMUSG00000001729
AA Change: M63K

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Pfam:Pkinase 150 202 2.6e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This gene encodes the founding member of the Akt serine-threonine protein kinase gene family that also includes Akt2 and Akt3. This kinase is a major downstream effector of the phosphatidylinositol 3-kinase (PI3K) pathway that mediates the effects of various growth factors such as platelet-derived growth factor (PDGF), epidermal growth factor (EGF), insulin and insulin-like growth factor I (IGF-I). It is activated through recruitment to cellular membranes by PI3K lipid products and by phosphorylation by 3-phosphoinositide dependent kinase-1. It then further phosphorylates different downstream proteins in response to various extracellular signals and thus plays a pivotal role in mediating a variety of cellular processes, such as glucose metabolism, glycogen biosynthesis, protein synthesis and turn over, inflammatory response, cell survival (anti-apoptosis) and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mutant homozygotes are smaller than sibs due to retarded prenatal and postnatal growth and exhibit increased apoptosis and decreased lifespan with genotoxic stress. Mice are fertile, but males have attenuated spermatogenesis and abnormal testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,355 E443G probably damaging Het
2700049A03Rik A G 12: 71,216,230 probably null Het
3110082I17Rik A G 5: 139,363,983 Y104H probably damaging Het
Abcg4 T C 9: 44,279,384 K282E probably benign Het
Adamts17 T C 7: 67,121,010 S956P probably damaging Het
Adh1 T C 3: 138,280,474 V74A probably damaging Het
Arfrp1 G A 2: 181,359,551 R177* probably null Het
Arl11 A G 14: 61,310,897 E52G possibly damaging Het
BC051019 T C 7: 109,720,618 S10G Het
Bfsp2 T A 9: 103,479,919 E103V probably damaging Het
Bms1 G T 6: 118,403,161 C728* probably null Het
Cachd1 T G 4: 100,918,066 N159K probably null Het
Cd38 A G 5: 43,910,309 N294S probably benign Het
Cfap54 T C 10: 93,016,571 N891S probably benign Het
Chsy3 A T 18: 59,410,298 H836L probably damaging Het
Cldn16 A T 16: 26,482,638 D232V probably damaging Het
Dhx33 A T 11: 70,993,863 I425N probably damaging Het
Dock4 A G 12: 40,828,879 N1506D probably damaging Het
Dok7 T C 5: 35,079,048 S227P probably damaging Het
Elf2 T C 3: 51,261,011 R201G probably damaging Het
Etaa1 T C 11: 17,940,339 R841G possibly damaging Het
Exoc4 T C 6: 33,971,999 Y926H probably damaging Het
Fras1 A G 5: 96,781,284 H3849R probably benign Het
Hapln3 C T 7: 79,121,824 G106R probably damaging Het
Hmcn1 A C 1: 150,577,210 probably null Het
Ifitm7 A T 16: 13,983,736 I53N possibly damaging Het
Ikbkap T C 4: 56,787,944 H329R probably damaging Het
Il6ra T C 3: 89,871,247 N433D probably damaging Het
Iqch C T 9: 63,421,909 V1048I probably benign Het
Kif20a A G 18: 34,632,535 T862A probably benign Het
Mcrs1 G A 15: 99,248,728 L141F probably damaging Het
Nkx3-2 A G 5: 41,761,674 S324P probably damaging Het
Nmi A T 2: 51,955,924 probably null Het
Nufip1 A G 14: 76,134,885 K480E possibly damaging Het
Oit3 T A 10: 59,428,344 I323F probably damaging Het
Olfr1450 A T 19: 12,954,114 H175L possibly damaging Het
Olfr699 T C 7: 106,790,483 K173E probably benign Het
Pcdha11 A G 18: 37,007,238 E640G probably benign Het
Phip C T 9: 82,877,300 V1366I probably damaging Het
Plin5 T C 17: 56,115,174 M162V probably null Het
Podxl2 A G 6: 88,843,505 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab4a A T 8: 123,827,330 D40V probably benign Het
Scn7a A G 2: 66,700,193 F603L probably benign Het
Slfn5 A T 11: 82,961,150 K701* probably null Het
Speer4f2 A G 5: 17,377,448 D223G Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tas2r117 A T 6: 132,803,387 T163S probably benign Het
Tecta T C 9: 42,347,991 D1532G probably damaging Het
Tmem63a T C 1: 180,954,876 I146T probably damaging Het
Ttn C A 2: 76,816,171 G12844W probably damaging Het
Usp22 T C 11: 61,162,949 I190V probably damaging Het
Usp24 T C 4: 106,362,215 I536T probably damaging Het
Vmn1r23 A G 6: 57,926,076 V239A possibly damaging Het
Vmn1r9 A C 6: 57,071,626 T229P probably damaging Het
Zbtb21 AGCTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC 16: 97,951,687 probably benign Het
Zbtb8a G C 4: 129,360,395 A102G probably damaging Het
Zfp51 T C 17: 21,461,709 W57R probably damaging Het
Other mutations in Akt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Akt1 APN 12 112657671 missense probably damaging 1.00
IGL01779:Akt1 APN 12 112657169 missense probably damaging 1.00
IGL01886:Akt1 APN 12 112659158 missense probably benign 0.16
IGL02506:Akt1 APN 12 112659280 splice site probably benign
IGL02851:Akt1 APN 12 112657084 missense probably damaging 1.00
R0211:Akt1 UTSW 12 112655142 missense probably damaging 0.98
R0211:Akt1 UTSW 12 112655142 missense probably damaging 0.98
R1891:Akt1 UTSW 12 112659575 missense probably damaging 1.00
R1988:Akt1 UTSW 12 112655151 missense probably benign 0.02
R2018:Akt1 UTSW 12 112659625 missense probably damaging 0.99
R2019:Akt1 UTSW 12 112659625 missense probably damaging 0.99
R2023:Akt1 UTSW 12 112659637 missense probably benign 0.33
R3873:Akt1 UTSW 12 112656533 missense probably benign
R4446:Akt1 UTSW 12 112659133 missense probably benign 0.05
R4832:Akt1 UTSW 12 112657087 missense probably damaging 1.00
R5457:Akt1 UTSW 12 112657091 missense probably damaging 0.96
R5595:Akt1 UTSW 12 112658616 missense probably null 0.99
R5723:Akt1 UTSW 12 112657270 missense probably damaging 1.00
R5736:Akt1 UTSW 12 112656850 missense probably benign 0.12
R6058:Akt1 UTSW 12 112662200 missense probably damaging 0.99
R6473:Akt1 UTSW 12 112662260 missense probably damaging 1.00
R7045:Akt1 UTSW 12 112662301 nonsense probably null
R7311:Akt1 UTSW 12 112657153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGTCTAGTTCTCCAGAATG -3'
(R):5'- TCTTTGAGAGGAACTAGGGCAAG -3'

Sequencing Primer
(F):5'- GTCTAGTTCTCCAGAATGGACTCAG -3'
(R):5'- GCCCCTGAAATCAATGTGTG -3'
Posted On2019-05-15