Incidental Mutation 'R7129:Olfr699'
ID552522
Institutional Source Beutler Lab
Gene Symbol Olfr699
Ensembl Gene ENSMUSG00000096714
Gene Nameolfactory receptor 699
SynonymsMOR283-10P, GA_x6K02T2PBJ9-9168355-9167405
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7129 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106787963-106793198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106790483 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 173 (K173E)
Ref Sequence ENSEMBL: ENSMUSP00000150923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065024] [ENSMUST00000215952] [ENSMUST00000216307]
Predicted Effect probably benign
Transcript: ENSMUST00000065024
AA Change: K173E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068023
Gene: ENSMUSG00000096714
AA Change: K173E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 303 2.1e-5 PFAM
Pfam:7tm_1 41 290 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215952
AA Change: K173E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216307
AA Change: K173E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,355 E443G probably damaging Het
2700049A03Rik A G 12: 71,216,230 probably null Het
3110082I17Rik A G 5: 139,363,983 Y104H probably damaging Het
Abcg4 T C 9: 44,279,384 K282E probably benign Het
Adamts17 T C 7: 67,121,010 S956P probably damaging Het
Adh1 T C 3: 138,280,474 V74A probably damaging Het
Akt1 A T 12: 112,659,649 M63K probably benign Het
Arfrp1 G A 2: 181,359,551 R177* probably null Het
Arl11 A G 14: 61,310,897 E52G possibly damaging Het
BC051019 T C 7: 109,720,618 S10G Het
Bfsp2 T A 9: 103,479,919 E103V probably damaging Het
Bms1 G T 6: 118,403,161 C728* probably null Het
Cachd1 T G 4: 100,918,066 N159K probably null Het
Cd38 A G 5: 43,910,309 N294S probably benign Het
Cfap54 T C 10: 93,016,571 N891S probably benign Het
Chsy3 A T 18: 59,410,298 H836L probably damaging Het
Cldn16 A T 16: 26,482,638 D232V probably damaging Het
Dhx33 A T 11: 70,993,863 I425N probably damaging Het
Dock4 A G 12: 40,828,879 N1506D probably damaging Het
Dok7 T C 5: 35,079,048 S227P probably damaging Het
Elf2 T C 3: 51,261,011 R201G probably damaging Het
Etaa1 T C 11: 17,940,339 R841G possibly damaging Het
Exoc4 T C 6: 33,971,999 Y926H probably damaging Het
Fras1 A G 5: 96,781,284 H3849R probably benign Het
Hapln3 C T 7: 79,121,824 G106R probably damaging Het
Hmcn1 A C 1: 150,577,210 probably null Het
Ifitm7 A T 16: 13,983,736 I53N possibly damaging Het
Ikbkap T C 4: 56,787,944 H329R probably damaging Het
Il6ra T C 3: 89,871,247 N433D probably damaging Het
Iqch C T 9: 63,421,909 V1048I probably benign Het
Kif20a A G 18: 34,632,535 T862A probably benign Het
Mcrs1 G A 15: 99,248,728 L141F probably damaging Het
Nkx3-2 A G 5: 41,761,674 S324P probably damaging Het
Nmi A T 2: 51,955,924 probably null Het
Nufip1 A G 14: 76,134,885 K480E possibly damaging Het
Oit3 T A 10: 59,428,344 I323F probably damaging Het
Olfr1450 A T 19: 12,954,114 H175L possibly damaging Het
Pcdha11 A G 18: 37,007,238 E640G probably benign Het
Phip C T 9: 82,877,300 V1366I probably damaging Het
Plin5 T C 17: 56,115,174 M162V probably null Het
Podxl2 A G 6: 88,843,505 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab4a A T 8: 123,827,330 D40V probably benign Het
Scn7a A G 2: 66,700,193 F603L probably benign Het
Slfn5 A T 11: 82,961,150 K701* probably null Het
Speer4f2 A G 5: 17,377,448 D223G Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tas2r117 A T 6: 132,803,387 T163S probably benign Het
Tecta T C 9: 42,347,991 D1532G probably damaging Het
Tmem63a T C 1: 180,954,876 I146T probably damaging Het
Ttn C A 2: 76,816,171 G12844W probably damaging Het
Usp22 T C 11: 61,162,949 I190V probably damaging Het
Usp24 T C 4: 106,362,215 I536T probably damaging Het
Vmn1r23 A G 6: 57,926,076 V239A possibly damaging Het
Vmn1r9 A C 6: 57,071,626 T229P probably damaging Het
Zbtb21 AGCTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC 16: 97,951,687 probably benign Het
Zbtb8a G C 4: 129,360,395 A102G probably damaging Het
Zfp51 T C 17: 21,461,709 W57R probably damaging Het
Other mutations in Olfr699
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr699 APN 7 106790589 missense probably benign 0.12
IGL02093:Olfr699 APN 7 106790823 missense probably benign 0.12
IGL02404:Olfr699 APN 7 106790359 missense probably damaging 1.00
IGL03214:Olfr699 APN 7 106790345 missense probably benign
IGL03230:Olfr699 APN 7 106790704 missense probably damaging 1.00
R0194:Olfr699 UTSW 7 106790823 missense probably benign 0.12
R0523:Olfr699 UTSW 7 106790326 missense probably damaging 1.00
R1132:Olfr699 UTSW 7 106790551 missense possibly damaging 0.94
R1373:Olfr699 UTSW 7 106790756 missense probably benign 0.01
R1482:Olfr699 UTSW 7 106790333 missense probably benign 0.00
R1498:Olfr699 UTSW 7 106790416 missense possibly damaging 0.78
R1500:Olfr699 UTSW 7 106790821 missense probably damaging 1.00
R2656:Olfr699 UTSW 7 106790513 missense probably damaging 0.98
R4163:Olfr699 UTSW 7 106790279 missense probably damaging 1.00
R4638:Olfr699 UTSW 7 106790998 start codon destroyed probably null 1.00
R5104:Olfr699 UTSW 7 106790332 missense possibly damaging 0.81
R6216:Olfr699 UTSW 7 106790458 missense probably benign 0.23
R6976:Olfr699 UTSW 7 106790227 missense probably damaging 0.99
R7130:Olfr699 UTSW 7 106790182 missense probably benign 0.35
Z1177:Olfr699 UTSW 7 106790270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGACAAGTGCTTTCTTCC -3'
(R):5'- TTGGTGGTGCAGAAGACCTC -3'

Sequencing Primer
(F):5'- GTGACAAGTGCTTTCTTCCTTCCTTC -3'
(R):5'- GAAGACCTCCTTCTGGCCTTCATG -3'
Posted On2019-05-15