Incidental Mutation 'R7138:Olfr648'
ID553196
Institutional Source Beutler Lab
Gene Symbol Olfr648
Ensembl Gene ENSMUSG00000042909
Gene Nameolfactory receptor 648
SynonymsGA_x6K02T2PBJ9-6914780-6913830, MOR31-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R7138 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104177598-104183392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104180297 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 37 (Y37C)
Ref Sequence ENSEMBL: ENSMUSP00000149047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052659] [ENSMUST00000216612]
Predicted Effect probably damaging
Transcript: ENSMUST00000052659
AA Change: Y37C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062529
Gene: ENSMUSG00000042909
AA Change: Y37C

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 2e-111 PFAM
Pfam:7TM_GPCR_Srsx 37 309 7.7e-7 PFAM
Pfam:7tm_1 43 294 3.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216612
AA Change: Y37C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T A 16: 13,677,725 D229E probably benign Het
Abca4 T A 3: 122,105,464 C698* probably null Het
Acacb G A 5: 114,207,326 V947M probably benign Het
Acadsb T G 7: 131,441,239 L343R probably damaging Het
Adgrf2 C T 17: 42,710,983 E317K probably damaging Het
Agap2 A G 10: 127,087,285 T663A unknown Het
Akap8 A T 17: 32,316,541 F166L possibly damaging Het
Ankrd17 A T 5: 90,242,977 M2278K probably benign Het
Avl9 T C 6: 56,728,257 S148P probably damaging Het
Brf1 T C 12: 112,970,215 E266G probably damaging Het
Cabin1 T C 10: 75,745,353 K380E probably damaging Het
Catsper2 T C 2: 121,397,063 D542G possibly damaging Het
Cbln4 C A 2: 172,042,175 D42Y probably damaging Het
Cd5 C T 19: 10,720,304 R437Q probably damaging Het
Ceacam18 G C 7: 43,639,282 E152D possibly damaging Het
Chd8 A G 14: 52,214,498 S1347P possibly damaging Het
Chodl T G 16: 78,941,447 I101R probably damaging Het
Clk4 T G 11: 51,277,932 F377L probably damaging Het
Cntnap3 C T 13: 64,781,725 probably null Het
Dab2 A G 15: 6,429,299 S231G probably benign Het
Disp2 T A 2: 118,786,880 H118Q probably benign Het
Dnah10 T C 5: 124,822,945 F3869S probably damaging Het
Edil3 C T 13: 89,131,728 T175I probably damaging Het
Fap A G 2: 62,542,178 S319P probably benign Het
Frmpd2 T A 14: 33,571,804 V1309E probably benign Het
Galntl5 T A 5: 25,189,844 S70T probably benign Het
Gm16368 T G 12: 88,083,878 I61R probably damaging Het
Gm21994 T C 2: 150,255,452 H47R probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gna15 G A 10: 81,508,047 T260M probably damaging Het
Gucy2c A G 6: 136,728,344 I531T probably damaging Het
Heatr5b A G 17: 78,827,988 V238A probably damaging Het
Htr2a A G 14: 74,705,742 Y254C probably damaging Het
Inpp5b A G 4: 124,785,272 R491G probably damaging Het
Kcnt2 C T 1: 140,596,040 L1093F possibly damaging Het
Kcp C A 6: 29,491,862 E922* probably null Het
Lrp2 G A 2: 69,465,745 A3340V possibly damaging Het
Lrrn1 T G 6: 107,568,375 V378G probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Net1 G A 13: 3,888,510 R126C probably damaging Het
Nipsnap3a T C 4: 52,993,978 C20R probably benign Het
Nxpe2 C T 9: 48,320,706 C317Y probably damaging Het
Olfr1418 T A 19: 11,855,288 I222F probably damaging Het
Olfr145 T C 9: 37,898,064 I220T probably damaging Het
Olfr969 T G 9: 39,795,790 Y138* probably null Het
Orm1 T A 4: 63,344,712 W39R probably damaging Het
Pds5b A T 5: 150,800,677 K1240* probably null Het
Pdss1 T A 2: 22,912,669 H173Q probably damaging Het
Pebp1 A G 5: 117,285,817 W84R probably damaging Het
Pla2g16 T A 19: 7,579,185 V117E probably damaging Het
Pla2g4e C T 2: 120,171,278 C630Y probably damaging Het
Plekho2 G T 9: 65,556,353 Q405K probably benign Het
Plppr2 T A 9: 21,944,412 V227E probably damaging Het
Rapgef4 T C 2: 72,198,363 S393P probably damaging Het
Rapgefl1 A G 11: 98,847,074 probably null Het
Ripk3 C A 14: 55,788,346 R19L probably benign Het
Rnase10 G T 14: 51,009,710 V182F probably damaging Het
Rsf1 T A 7: 97,669,795 S917R Het
Sephs2 T C 7: 127,273,015 N302S possibly damaging Het
Slc13a2 C T 11: 78,399,124 V455M possibly damaging Het
Slc30a2 A T 4: 134,344,118 D54V probably benign Het
Slco6c1 T C 1: 97,119,981 E199G possibly damaging Het
Snx27 A T 3: 94,528,940 M256K probably benign Het
Spag4 T A 2: 156,066,599 S150T probably benign Het
Spon1 T A 7: 114,036,710 C720S probably damaging Het
Tbc1d22a T C 15: 86,239,155 S166P probably benign Het
Tbc1d9 T C 8: 83,210,484 I65T probably damaging Het
Tmem176a T A 6: 48,844,019 V141D probably damaging Het
Tmem268 G A 4: 63,562,450 probably benign Het
Tonsl A G 15: 76,634,776 V519A probably benign Het
Ttn G A 2: 76,782,032 P17204S possibly damaging Het
Wisp3 T A 10: 39,158,477 Q43L possibly damaging Het
Wrap53 T A 11: 69,563,868 D225V probably benign Het
Zfhx4 G A 3: 5,412,047 A3241T possibly damaging Het
Znfx1 T C 2: 167,056,777 R76G probably benign Het
Other mutations in Olfr648
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02121:Olfr648 APN 7 104180225 missense probably damaging 1.00
IGL02488:Olfr648 APN 7 104180271 missense possibly damaging 0.66
IGL02956:Olfr648 APN 7 104180127 missense probably damaging 1.00
R0001:Olfr648 UTSW 7 104179473 nonsense probably null
R0057:Olfr648 UTSW 7 104180329 missense probably benign 0.13
R1054:Olfr648 UTSW 7 104180291 missense probably benign 0.02
R1262:Olfr648 UTSW 7 104179416 splice site probably null
R4589:Olfr648 UTSW 7 104179429 splice site probably null
R4975:Olfr648 UTSW 7 104179529 missense probably damaging 1.00
R5068:Olfr648 UTSW 7 104180241 missense probably damaging 1.00
R5643:Olfr648 UTSW 7 104179884 missense probably benign 0.00
R6195:Olfr648 UTSW 7 104179754 missense possibly damaging 0.78
R6211:Olfr648 UTSW 7 104179747 nonsense probably null
R6233:Olfr648 UTSW 7 104179754 missense possibly damaging 0.78
R6259:Olfr648 UTSW 7 104180054 missense possibly damaging 0.53
R7357:Olfr648 UTSW 7 104179771 missense probably damaging 1.00
R7570:Olfr648 UTSW 7 104179748 missense probably damaging 1.00
R8352:Olfr648 UTSW 7 104179896 missense probably damaging 1.00
R8452:Olfr648 UTSW 7 104179896 missense probably damaging 1.00
X0018:Olfr648 UTSW 7 104179590 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAACATTTGTGTGAGGCAGC -3'
(R):5'- GTACATGGTTGCAAGTAACAGTG -3'

Sequencing Primer
(F):5'- CTGGAAATGTGATTTCTCGAGCCC -3'
(R):5'- CATGGTTGCAAGTAACAGTGACTCC -3'
Posted On2019-05-15