Incidental Mutation 'R7357:Olfr648'
ID571030
Institutional Source Beutler Lab
Gene Symbol Olfr648
Ensembl Gene ENSMUSG00000042909
Gene Nameolfactory receptor 648
SynonymsGA_x6K02T2PBJ9-6914780-6913830, MOR31-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R7357 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104177598-104183392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104179771 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 212 (D212E)
Ref Sequence ENSEMBL: ENSMUSP00000149047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052659] [ENSMUST00000216612]
Predicted Effect probably damaging
Transcript: ENSMUST00000052659
AA Change: D212E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062529
Gene: ENSMUSG00000042909
AA Change: D212E

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 2e-111 PFAM
Pfam:7TM_GPCR_Srsx 37 309 7.7e-7 PFAM
Pfam:7tm_1 43 294 3.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216612
AA Change: D212E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A T 2: 156,003,867 H23Q unknown Het
9530068E07Rik A T 11: 52,406,994 K233I probably damaging Het
Aldh1l2 T C 10: 83,514,544 M320V possibly damaging Het
C2cd3 A G 7: 100,430,103 N838S Het
Cacna1s T C 1: 136,071,021 F218S probably damaging Het
Carmil3 G T 14: 55,491,133 probably benign Het
Cd300a A T 11: 114,893,327 T54S probably benign Het
Celf3 G A 3: 94,480,330 E70K probably damaging Het
Celsr1 A C 15: 86,030,514 M1086R probably benign Het
Ces2f G A 8: 104,949,963 M96I probably benign Het
Chrdl2 G A 7: 100,029,207 V329I probably benign Het
Ctc1 T A 11: 69,034,742 L1035Q probably benign Het
Dbi A G 1: 120,119,893 probably null Het
Dock3 A G 9: 107,005,369 I405T probably benign Het
Dpp4 A T 2: 62,387,077 W59R probably benign Het
Dsg3 T A 18: 20,539,783 I837N probably damaging Het
Fbxw15 A G 9: 109,558,240 V229A probably benign Het
Fermt3 T C 19: 7,002,843 T395A probably benign Het
Focad A T 4: 88,229,335 I404F probably benign Het
Gm4869 A G 5: 140,495,051 R979G possibly damaging Het
Gm8104 T C 14: 43,101,611 I86T probably damaging Het
Gm9857 A C 3: 108,940,162 L95R unknown Het
Hoxa1 A T 6: 52,156,949 S266T probably benign Het
Leng8 T A 7: 4,144,933 Y625* probably null Het
Mast3 A G 8: 70,784,859 V557A probably damaging Het
Morc1 T C 16: 48,622,590 F813L probably benign Het
Ntf3 T A 6: 126,101,998 I182F probably damaging Het
Nup153 G T 13: 46,717,166 A91E probably benign Het
Olfr1402 G C 3: 97,410,655 N175K probably damaging Het
Pamr1 G A 2: 102,586,704 W120* probably null Het
Pcsk1 A G 13: 75,125,960 N436S probably damaging Het
Pde4dip T C 3: 97,715,541 K1451E probably benign Het
Pebp4 G A 14: 70,048,415 V176I possibly damaging Het
Phgdh G A 3: 98,339,822 A4V probably benign Het
Pik3c2g T C 6: 139,633,793 probably null Het
Ppic T C 18: 53,411,067 Y82C probably damaging Het
Ppip5k2 A G 1: 97,759,216 V94A possibly damaging Het
Ppp1r9b T C 11: 95,004,598 V704A probably benign Het
Pramel6 G T 2: 87,510,512 R396L not run Het
Prss48 A T 3: 85,997,221 D223E probably damaging Het
Psd3 T C 8: 68,121,497 K11E probably benign Het
Rabgap1l T C 1: 160,342,038 K780E probably damaging Het
Retreg1 A T 15: 25,971,943 D323V probably damaging Het
Samd11 A T 4: 156,255,007 probably null Het
Sec14l3 T A 11: 4,070,127 F188Y probably benign Het
Serpina5 A T 12: 104,103,380 T284S possibly damaging Het
Setx A G 2: 29,130,301 D100G probably benign Het
Sis A T 3: 72,925,071 V1035D probably damaging Het
Slco4a1 A G 2: 180,472,137 I456V probably benign Het
Snx14 A T 9: 88,404,316 C393S possibly damaging Het
Stil T C 4: 115,014,226 probably null Het
Sult6b1 A G 17: 78,894,630 S148P probably damaging Het
Sycp2 G T 2: 178,403,804 probably null Het
Tesmin T C 19: 3,397,042 I273T probably benign Het
Tmem39a T A 16: 38,586,230 Y310N probably damaging Het
Trp53bp1 A T 2: 121,211,300 D1258E probably damaging Het
Ttc12 A C 9: 49,438,387 D703E probably benign Het
Unc13c TATAA TATAATAA 9: 73,933,528 probably benign Het
Unc13c ATA ATAGTA 9: 73,933,529 probably benign Het
Usp18 T C 6: 121,253,849 I79T possibly damaging Het
Usp9y A T Y: 1,333,656 D1596E possibly damaging Het
Vmn2r109 A T 17: 20,541,274 V607E probably damaging Het
Vwa8 G A 14: 79,038,201 R808K probably null Het
Zfp248 A G 6: 118,429,657 Y324H probably damaging Het
Zfp513 G A 5: 31,199,788 P387S possibly damaging Het
Other mutations in Olfr648
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02121:Olfr648 APN 7 104180225 missense probably damaging 1.00
IGL02488:Olfr648 APN 7 104180271 missense possibly damaging 0.66
IGL02956:Olfr648 APN 7 104180127 missense probably damaging 1.00
R0001:Olfr648 UTSW 7 104179473 nonsense probably null
R0057:Olfr648 UTSW 7 104180329 missense probably benign 0.13
R1054:Olfr648 UTSW 7 104180291 missense probably benign 0.02
R1262:Olfr648 UTSW 7 104179416 splice site probably null
R4589:Olfr648 UTSW 7 104179429 splice site probably null
R4975:Olfr648 UTSW 7 104179529 missense probably damaging 1.00
R5068:Olfr648 UTSW 7 104180241 missense probably damaging 1.00
R5643:Olfr648 UTSW 7 104179884 missense probably benign 0.00
R6195:Olfr648 UTSW 7 104179754 missense possibly damaging 0.78
R6211:Olfr648 UTSW 7 104179747 nonsense probably null
R6233:Olfr648 UTSW 7 104179754 missense possibly damaging 0.78
R6259:Olfr648 UTSW 7 104180054 missense possibly damaging 0.53
R7138:Olfr648 UTSW 7 104180297 missense probably damaging 1.00
R7570:Olfr648 UTSW 7 104179748 missense probably damaging 1.00
R8352:Olfr648 UTSW 7 104179896 missense probably damaging 1.00
R8452:Olfr648 UTSW 7 104179896 missense probably damaging 1.00
X0018:Olfr648 UTSW 7 104179590 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTGTGTCCAAAGCGATGAGC -3'
(R):5'- ATGTGGCCATCTGTTCACCC -3'

Sequencing Primer
(F):5'- GCGATGAGCGAGGATGG -3'
(R):5'- CCAAGACTATCGTCAAGATTGCTGTG -3'
Posted On2019-09-13