Incidental Mutation 'R7138:Cntnap3'
ID553217
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Namecontactin associated protein-like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7138 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location64736182-64903955 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 64781725 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
Predicted Effect probably null
Transcript: ENSMUST00000091554
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T A 16: 13,677,725 D229E probably benign Het
Abca4 T A 3: 122,105,464 C698* probably null Het
Acacb G A 5: 114,207,326 V947M probably benign Het
Acadsb T G 7: 131,441,239 L343R probably damaging Het
Adgrf2 C T 17: 42,710,983 E317K probably damaging Het
Agap2 A G 10: 127,087,285 T663A unknown Het
Akap8 A T 17: 32,316,541 F166L possibly damaging Het
Ankrd17 A T 5: 90,242,977 M2278K probably benign Het
Avl9 T C 6: 56,728,257 S148P probably damaging Het
Brf1 T C 12: 112,970,215 E266G probably damaging Het
Cabin1 T C 10: 75,745,353 K380E probably damaging Het
Catsper2 T C 2: 121,397,063 D542G possibly damaging Het
Cbln4 C A 2: 172,042,175 D42Y probably damaging Het
Cd5 C T 19: 10,720,304 R437Q probably damaging Het
Ceacam18 G C 7: 43,639,282 E152D possibly damaging Het
Chd8 A G 14: 52,214,498 S1347P possibly damaging Het
Chodl T G 16: 78,941,447 I101R probably damaging Het
Clk4 T G 11: 51,277,932 F377L probably damaging Het
Dab2 A G 15: 6,429,299 S231G probably benign Het
Disp2 T A 2: 118,786,880 H118Q probably benign Het
Dnah10 T C 5: 124,822,945 F3869S probably damaging Het
Edil3 C T 13: 89,131,728 T175I probably damaging Het
Fap A G 2: 62,542,178 S319P probably benign Het
Frmpd2 T A 14: 33,571,804 V1309E probably benign Het
Galntl5 T A 5: 25,189,844 S70T probably benign Het
Gm16368 T G 12: 88,083,878 I61R probably damaging Het
Gm21994 T C 2: 150,255,452 H47R probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gna15 G A 10: 81,508,047 T260M probably damaging Het
Gucy2c A G 6: 136,728,344 I531T probably damaging Het
Heatr5b A G 17: 78,827,988 V238A probably damaging Het
Htr2a A G 14: 74,705,742 Y254C probably damaging Het
Inpp5b A G 4: 124,785,272 R491G probably damaging Het
Kcnt2 C T 1: 140,596,040 L1093F possibly damaging Het
Kcp C A 6: 29,491,862 E922* probably null Het
Lrp2 G A 2: 69,465,745 A3340V possibly damaging Het
Lrrn1 T G 6: 107,568,375 V378G probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Net1 G A 13: 3,888,510 R126C probably damaging Het
Nipsnap3a T C 4: 52,993,978 C20R probably benign Het
Nxpe2 C T 9: 48,320,706 C317Y probably damaging Het
Olfr1418 T A 19: 11,855,288 I222F probably damaging Het
Olfr145 T C 9: 37,898,064 I220T probably damaging Het
Olfr648 T C 7: 104,180,297 Y37C probably damaging Het
Olfr969 T G 9: 39,795,790 Y138* probably null Het
Orm1 T A 4: 63,344,712 W39R probably damaging Het
Pds5b A T 5: 150,800,677 K1240* probably null Het
Pdss1 T A 2: 22,912,669 H173Q probably damaging Het
Pebp1 A G 5: 117,285,817 W84R probably damaging Het
Pla2g16 T A 19: 7,579,185 V117E probably damaging Het
Pla2g4e C T 2: 120,171,278 C630Y probably damaging Het
Plekho2 G T 9: 65,556,353 Q405K probably benign Het
Plppr2 T A 9: 21,944,412 V227E probably damaging Het
Rapgef4 T C 2: 72,198,363 S393P probably damaging Het
Rapgefl1 A G 11: 98,847,074 probably null Het
Ripk3 C A 14: 55,788,346 R19L probably benign Het
Rnase10 G T 14: 51,009,710 V182F probably damaging Het
Rsf1 T A 7: 97,669,795 S917R Het
Sephs2 T C 7: 127,273,015 N302S possibly damaging Het
Slc13a2 C T 11: 78,399,124 V455M possibly damaging Het
Slc30a2 A T 4: 134,344,118 D54V probably benign Het
Slco6c1 T C 1: 97,119,981 E199G possibly damaging Het
Snx27 A T 3: 94,528,940 M256K probably benign Het
Spag4 T A 2: 156,066,599 S150T probably benign Het
Spon1 T A 7: 114,036,710 C720S probably damaging Het
Tbc1d22a T C 15: 86,239,155 S166P probably benign Het
Tbc1d9 T C 8: 83,210,484 I65T probably damaging Het
Tmem176a T A 6: 48,844,019 V141D probably damaging Het
Tmem268 G A 4: 63,562,450 probably benign Het
Tonsl A G 15: 76,634,776 V519A probably benign Het
Ttn G A 2: 76,782,032 P17204S possibly damaging Het
Wisp3 T A 10: 39,158,477 Q43L possibly damaging Het
Wrap53 T A 11: 69,563,868 D225V probably benign Het
Zfhx4 G A 3: 5,412,047 A3241T possibly damaging Het
Znfx1 T C 2: 167,056,777 R76G probably benign Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64772777 nonsense probably null
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64787867 missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64738665 missense probably benign 0.31
Z1176:Cntnap3 UTSW 13 64740872 frame shift probably null
Z1176:Cntnap3 UTSW 13 64792388 missense probably damaging 0.98
Z1177:Cntnap3 UTSW 13 64781892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACACAAGTGCATCTGTGTCAG -3'
(R):5'- TTGTCCCAACAACAGCTCTAGC -3'

Sequencing Primer
(F):5'- TGGTAACAGCTGAGCCATC -3'
(R):5'- CTCTAGCTTTGGATGTGAACATTC -3'
Posted On2019-05-15