Mutagenetix > Incidental Mutation

Incidental Mutation 'R7138:Cntnap3'

553217

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

045249-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R7138 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 64781725 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably null
Transcript: ENSMUST00000091554

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110001I22Rik	T	A	16: 13,677,725	D229E	probably benign	Het
Abca4	T	A	3: 122,105,464	C698*	probably null	Het
Acacb	G	A	5: 114,207,326	V947M	probably benign	Het
Acadsb	T	G	7: 131,441,239	L343R	probably damaging	Het
Adgrf2	C	T	17: 42,710,983	E317K	probably damaging	Het
Agap2	A	G	10: 127,087,285	T663A	unknown	Het
Akap8	A	T	17: 32,316,541	F166L	possibly damaging	Het
Ankrd17	A	T	5: 90,242,977	M2278K	probably benign	Het
Avl9	T	C	6: 56,728,257	S148P	probably damaging	Het
Brf1	T	C	12: 112,970,215	E266G	probably damaging	Het
Cabin1	T	C	10: 75,745,353	K380E	probably damaging	Het
Catsper2	T	C	2: 121,397,063	D542G	possibly damaging	Het
Cbln4	C	A	2: 172,042,175	D42Y	probably damaging	Het
Cd5	C	T	19: 10,720,304	R437Q	probably damaging	Het
Ceacam18	G	C	7: 43,639,282	E152D	possibly damaging	Het
Chd8	A	G	14: 52,214,498	S1347P	possibly damaging	Het
Chodl	T	G	16: 78,941,447	I101R	probably damaging	Het
Clk4	T	G	11: 51,277,932	F377L	probably damaging	Het
Dab2	A	G	15: 6,429,299	S231G	probably benign	Het
Disp2	T	A	2: 118,786,880	H118Q	probably benign	Het
Dnah10	T	C	5: 124,822,945	F3869S	probably damaging	Het
Edil3	C	T	13: 89,131,728	T175I	probably damaging	Het
Fap	A	G	2: 62,542,178	S319P	probably benign	Het
Frmpd2	T	A	14: 33,571,804	V1309E	probably benign	Het
Galntl5	T	A	5: 25,189,844	S70T	probably benign	Het
Gm16368	T	G	12: 88,083,878	I61R	probably damaging	Het
Gm21994	T	C	2: 150,255,452	H47R	probably damaging	Het
Gm5622	G	T	14: 51,655,882	E89*	probably null	Het
Gna15	G	A	10: 81,508,047	T260M	probably damaging	Het
Gucy2c	A	G	6: 136,728,344	I531T	probably damaging	Het
Heatr5b	A	G	17: 78,827,988	V238A	probably damaging	Het
Htr2a	A	G	14: 74,705,742	Y254C	probably damaging	Het
Inpp5b	A	G	4: 124,785,272	R491G	probably damaging	Het
Kcnt2	C	T	1: 140,596,040	L1093F	possibly damaging	Het
Kcp	C	A	6: 29,491,862	E922*	probably null	Het
Lrp2	G	A	2: 69,465,745	A3340V	possibly damaging	Het
Lrrn1	T	G	6: 107,568,375	V378G	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Net1	G	A	13: 3,888,510	R126C	probably damaging	Het
Nipsnap3a	T	C	4: 52,993,978	C20R	probably benign	Het
Nxpe2	C	T	9: 48,320,706	C317Y	probably damaging	Het
Olfr1418	T	A	19: 11,855,288	I222F	probably damaging	Het
Olfr145	T	C	9: 37,898,064	I220T	probably damaging	Het
Olfr648	T	C	7: 104,180,297	Y37C	probably damaging	Het
Olfr969	T	G	9: 39,795,790	Y138*	probably null	Het
Orm1	T	A	4: 63,344,712	W39R	probably damaging	Het
Pds5b	A	T	5: 150,800,677	K1240*	probably null	Het
Pdss1	T	A	2: 22,912,669	H173Q	probably damaging	Het
Pebp1	A	G	5: 117,285,817	W84R	probably damaging	Het
Pla2g16	T	A	19: 7,579,185	V117E	probably damaging	Het
Pla2g4e	C	T	2: 120,171,278	C630Y	probably damaging	Het
Plekho2	G	T	9: 65,556,353	Q405K	probably benign	Het
Plppr2	T	A	9: 21,944,412	V227E	probably damaging	Het
Rapgef4	T	C	2: 72,198,363	S393P	probably damaging	Het
Rapgefl1	A	G	11: 98,847,074		probably null	Het
Ripk3	C	A	14: 55,788,346	R19L	probably benign	Het
Rnase10	G	T	14: 51,009,710	V182F	probably damaging	Het
Rsf1	T	A	7: 97,669,795	S917R		Het
Sephs2	T	C	7: 127,273,015	N302S	possibly damaging	Het
Slc13a2	C	T	11: 78,399,124	V455M	possibly damaging	Het
Slc30a2	A	T	4: 134,344,118	D54V	probably benign	Het
Slco6c1	T	C	1: 97,119,981	E199G	possibly damaging	Het
Snx27	A	T	3: 94,528,940	M256K	probably benign	Het
Spag4	T	A	2: 156,066,599	S150T	probably benign	Het
Spon1	T	A	7: 114,036,710	C720S	probably damaging	Het
Tbc1d22a	T	C	15: 86,239,155	S166P	probably benign	Het
Tbc1d9	T	C	8: 83,210,484	I65T	probably damaging	Het
Tmem176a	T	A	6: 48,844,019	V141D	probably damaging	Het
Tmem268	G	A	4: 63,562,450		probably benign	Het
Tonsl	A	G	15: 76,634,776	V519A	probably benign	Het
Ttn	G	A	2: 76,782,032	P17204S	possibly damaging	Het
Wisp3	T	A	10: 39,158,477	Q43L	possibly damaging	Het
Wrap53	T	A	11: 69,563,868	D225V	probably benign	Het
Zfhx4	G	A	3: 5,412,047	A3241T	possibly damaging	Het
Znfx1	T	C	2: 167,056,777	R76G	probably benign	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CACACAAGTGCATCTGTGTCAG -3'
(R):5'- TTGTCCCAACAACAGCTCTAGC -3'

Sequencing Primer
(F):5'- TGGTAACAGCTGAGCCATC -3'
(R):5'- CTCTAGCTTTGGATGTGAACATTC -3'

Posted On

2019-05-15