Incidental Mutation 'R7043:Trp73'
ID557111
Institutional Source Beutler Lab
Gene Symbol Trp73
Ensembl Gene ENSMUSG00000029026
Gene Nametransformation related protein 73
SynonymsdeltaNp73, p73, TAp73
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location154056253-154140208 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to G at 154067007 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097762] [ENSMUST00000097763] [ENSMUST00000105643] [ENSMUST00000105644] [ENSMUST00000133533] [ENSMUST00000139634] [ENSMUST00000155642]
Predicted Effect probably null
Transcript: ENSMUST00000097762
SMART Domains Protein: ENSMUSP00000095368
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 2.6e-111 PFAM
Pfam:P53_tetramer 296 337 8.5e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Pfam:SAM_2 352 406 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097763
SMART Domains Protein: ENSMUSP00000134196
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 6.4e-112 PFAM
Pfam:P53_tetramer 296 337 2.3e-21 PFAM
low complexity region 341 362 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105643
SMART Domains Protein: ENSMUSP00000101268
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 2.1e-111 PFAM
Pfam:P53_tetramer 296 337 7.6e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105644
SMART Domains Protein: ENSMUSP00000101269
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 112 308 3.1e-115 PFAM
Pfam:P53_tetramer 344 383 8.3e-21 PFAM
low complexity region 390 398 N/A INTRINSIC
SAM 486 552 2.71e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000133533
SMART Domains Protein: ENSMUSP00000114418
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 3.8e-111 PFAM
Pfam:P53_tetramer 296 337 1.1e-20 PFAM
low complexity region 342 350 N/A INTRINSIC
SAM 438 504 2.71e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139634
SMART Domains Protein: ENSMUSP00000114736
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:P53 152 204 3.1e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155642
SMART Domains Protein: ENSMUSP00000135281
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 42 213 1.3e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes tumor protein p73, which is a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include p53, p63, and p73 and have high sequence similarity to one another, which allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways involving direct or indirect protein interactions, resulting in regulation of the same target gene promoters or regulation of each other's promoters. The p73 protein is expressed at very low levels in normal tissues and is differentially expressed in a number of tumors. The p73 gene expresses at least 35 mRNA variants due to the use of alternate promoters, alternate translation initiation sites, and multiple splice variations. Theoretically this can account for 29 different p73 isoforms; however, the biological validity and the full-length nature of most variants have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display a variety of defects including hippocampal dysgenesis, hydrocephalus, chronic infections and inflammation, abnormal pheromone sensory pathways, eye abnormalities, impaired growth, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in Trp73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Trp73 APN 4 154081486 missense possibly damaging 0.82
IGL02264:Trp73 APN 4 154064428 missense probably null 0.98
IGL02344:Trp73 APN 4 154062043 missense possibly damaging 0.92
IGL02663:Trp73 APN 4 154062506 splice site probably null
IGL02956:Trp73 APN 4 154064463 splice site probably benign
IGL03093:Trp73 APN 4 154104873 missense probably benign 0.00
slowpoke UTSW 4 154064632 splice site probably null
R0238:Trp73 UTSW 4 154062524 unclassified probably benign
R0238:Trp73 UTSW 4 154062524 unclassified probably benign
R0363:Trp73 UTSW 4 154063949 missense probably benign 0.17
R0409:Trp73 UTSW 4 154064384 missense possibly damaging 0.81
R1161:Trp73 UTSW 4 154081323 splice site probably null
R1531:Trp73 UTSW 4 154063895 missense probably benign 0.31
R2002:Trp73 UTSW 4 154081445 missense probably damaging 1.00
R2185:Trp73 UTSW 4 154104817 critical splice donor site probably null
R3965:Trp73 UTSW 4 154062036 missense probably benign 0.03
R3966:Trp73 UTSW 4 154062036 missense probably benign 0.03
R4247:Trp73 UTSW 4 154064632 splice site probably null
R4595:Trp73 UTSW 4 154064417 missense probably damaging 0.99
R5170:Trp73 UTSW 4 154104838 missense possibly damaging 0.95
R5260:Trp73 UTSW 4 154062602 missense possibly damaging 0.48
R5622:Trp73 UTSW 4 154060592 missense possibly damaging 0.68
R6173:Trp73 UTSW 4 154104341 missense probably damaging 1.00
R6252:Trp73 UTSW 4 154064397 missense probably damaging 1.00
R6950:Trp73 UTSW 4 154062053 missense probably benign 0.18
R7050:Trp73 UTSW 4 154081442 missense probably damaging 1.00
R7052:Trp73 UTSW 4 154064683 missense probably damaging 0.98
R7620:Trp73 UTSW 4 154059257 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAGGTCATATAACTATACCTCGC -3'
(R):5'- ATGAGGGTTGCACAGCTCTG -3'

Sequencing Primer
(F):5'- CTCGCTATATAGCTGAGGCGAG -3'
(R):5'- GTTGCACAGCTCTGAGCCTTG -3'
Posted On2019-06-21