Mutagenetix > Incidental Mutations

Incidental Mutation 'R7043:Trp73'

557111

Institutional Source

Beutler Lab

Gene Symbol

Trp73

Ensembl Gene

ENSMUSG00000029026

Gene Name

transformation related protein 73

Synonyms

deltaNp73, p73, TAp73

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.524) question?

Stock #

R7043 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

154056253-154140208 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to G at 154067007 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000135281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097762] [ENSMUST00000097763] [ENSMUST00000105643] [ENSMUST00000105644] [ENSMUST00000133533] [ENSMUST00000139634] [ENSMUST00000155642]

Predicted Effect

probably null
Transcript: ENSMUST00000097762

SMART Domains

Protein: ENSMUSP00000095368
Gene: ENSMUSG00000029026

Domain	Start	End	E-Value	Type
Pfam:P53	64	260	2.6e-111	PFAM
Pfam:P53_tetramer	296	337	8.5e-21	PFAM
low complexity region	342	350	N/A	INTRINSIC
Pfam:SAM_2	352	406	1.3e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000097763

SMART Domains

Protein: ENSMUSP00000134196
Gene: ENSMUSG00000029026

Domain	Start	End	E-Value	Type
Pfam:P53	64	260	6.4e-112	PFAM
Pfam:P53_tetramer	296	337	2.3e-21	PFAM
low complexity region	341	362	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000105643

SMART Domains

Protein: ENSMUSP00000101268
Gene: ENSMUSG00000029026

Domain	Start	End	E-Value	Type
Pfam:P53	64	260	2.1e-111	PFAM
Pfam:P53_tetramer	296	337	7.6e-21	PFAM
low complexity region	342	350	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000105644

SMART Domains

Protein: ENSMUSP00000101269
Gene: ENSMUSG00000029026

Domain	Start	End	E-Value	Type
Pfam:P53	112	308	3.1e-115	PFAM
Pfam:P53_tetramer	344	383	8.3e-21	PFAM
low complexity region	390	398	N/A	INTRINSIC
SAM	486	552	2.71e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000133533

SMART Domains

Protein: ENSMUSP00000114418
Gene: ENSMUSG00000029026

Domain	Start	End	E-Value	Type
Pfam:P53	64	260	3.8e-111	PFAM
Pfam:P53_tetramer	296	337	1.1e-20	PFAM
low complexity region	342	350	N/A	INTRINSIC
SAM	438	504	2.71e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139634

SMART Domains

Protein: ENSMUSP00000114736
Gene: ENSMUSG00000029026

Domain	Start	End	E-Value	Type
low complexity region	9	27	N/A	INTRINSIC
Pfam:P53	152	204	3.1e-25	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000155642

SMART Domains

Protein: ENSMUSP00000135281
Gene: ENSMUSG00000029026

Domain	Start	End	E-Value	Type
Pfam:P53	42	213	1.3e-94	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: This gene encodes tumor protein p73, which is a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include p53, p63, and p73 and have high sequence similarity to one another, which allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways involving direct or indirect protein interactions, resulting in regulation of the same target gene promoters or regulation of each other's promoters. The p73 protein is expressed at very low levels in normal tissues and is differentially expressed in a number of tumors. The p73 gene expresses at least 35 mRNA variants due to the use of alternate promoters, alternate translation initiation sites, and multiple splice variations. Theoretically this can account for 29 different p73 isoforms; however, the biological validity and the full-length nature of most variants have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display a variety of defects including hippocampal dysgenesis, hydrocephalus, chronic infections and inflammation, abnormal pheromone sensory pathways, eye abnormalities, impaired growth, and female infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	C	17: 33,065,332	D832G	possibly damaging	Het
Abca17	A	G	17: 24,265,500	L1596P	probably damaging	Het
Actr3b	A	G	5: 25,849,938	M329V	probably benign	Het
Avpr1a	C	T	10: 122,449,681	R293C	probably damaging	Het
Bdp1	A	T	13: 100,078,707	C390S	probably benign	Het
C2cd2l	A	T	9: 44,316,551	M131K	probably damaging	Het
Ccna2	T	C	3: 36,570,153		probably benign	Het
Cd53	T	C	3: 106,763,261	D152G	probably damaging	Het
Cdpf1	A	T	15: 85,808,284	V66E	probably null	Het
Chd9	G	T	8: 91,034,215		probably benign	Het
Crybg2	A	G	4: 134,091,136	D1710G	probably benign	Het
Dst	A	G	1: 34,257,911	T5794A	probably damaging	Het
Eif2s1	G	T	12: 78,877,108	R113L	probably damaging	Het
Eif5	A	G	12: 111,544,596	D423G	probably benign	Het
Eri1	A	C	8: 35,478,638	D164E	probably damaging	Het
F7	A	T	8: 13,033,997	R227S	probably benign	Het
Gm14496	T	G	2: 182,000,327	I597S	possibly damaging	Het
Gpr85	T	A	6: 13,835,877	N343Y	probably damaging	Het
H2-T23	A	T	17: 36,031,911	S112T	probably damaging	Het
Itga9	C	T	9: 118,769,116	P573S	probably damaging	Het
Kcnb2	A	T	1: 15,312,926	M159L	probably benign	Het
Kmt5b	T	A	19: 3,815,220	S738R	possibly damaging	Het
Lrp1b	T	C	2: 40,922,414	N2393S	possibly damaging	Het
Mme	T	A	3: 63,345,217	Y427*	probably null	Het
Naip1	A	G	13: 100,426,914	V581A	probably damaging	Het
Ndel1	A	G	11: 68,822,624	L329P	possibly damaging	Het
Nthl1	T	G	17: 24,638,670	V281G	probably benign	Het
Olfr597	C	A	7: 103,321,085		probably benign	Het
Per2	G	T	1: 91,419,408	H1197Q	probably benign	Het
Plec	G	A	15: 76,209,128		probably benign	Het
Prpf6	A	T	2: 181,649,504	H704L	probably benign	Het
Recql5	C	T	11: 115,930,676		probably null	Het
Rimbp3	G	A	16: 17,211,108	V799M	probably damaging	Het
Sema3f	C	T	9: 107,691,400	A169T	possibly damaging	Het
Serpinb9f	T	C	13: 33,325,987	I54T	possibly damaging	Het
Skint5	A	T	4: 113,717,107	L749Q	unknown	Het
Slc35g3	T	C	11: 69,761,650	D12G	probably benign	Het
Sptbn1	A	G	11: 30,103,323	V2252A	probably benign	Het
Stab2	T	C	10: 86,870,246	N1750S	probably damaging	Het
Supt5	C	A	7: 28,320,010	R543L	probably benign	Het
Syne1	T	C	10: 5,072,193	E7806G	possibly damaging	Het
Syt12	T	A	19: 4,451,021	M334L	probably benign	Het
Tk1	A	G	11: 117,815,953	*234R	probably null	Het
Ttn	A	G	2: 76,897,133		probably benign	Het
Vmn2r11	T	C	5: 109,052,232	I452V	probably benign	Het
Wwox	G	T	8: 114,679,838	V190L	probably damaging	Het
Wwp2	A	G	8: 107,457,900	H80R	probably benign	Het
Zc3h3	A	G	15: 75,809,636	I532T	probably damaging	Het
Zfp280d	A	G	9: 72,319,257	K328E	probably damaging	Het
Zfp365	A	G	10: 67,909,826	S41P	probably damaging	Het

Other mutations in Trp73

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02150:Trp73	APN	4	154081486	missense	possibly damaging	0.82
IGL02264:Trp73	APN	4	154064428	missense	probably null	0.98
IGL02344:Trp73	APN	4	154062043	missense	possibly damaging	0.92
IGL02663:Trp73	APN	4	154062506	splice site	probably null
IGL02956:Trp73	APN	4	154064463	splice site	probably benign
IGL03093:Trp73	APN	4	154104873	missense	probably benign	0.00
slowpoke	UTSW	4	154064632	splice site	probably null
R0238:Trp73	UTSW	4	154062524	unclassified	probably benign
R0238:Trp73	UTSW	4	154062524	unclassified	probably benign
R0363:Trp73	UTSW	4	154063949	missense	probably benign	0.17
R0409:Trp73	UTSW	4	154064384	missense	possibly damaging	0.81
R1161:Trp73	UTSW	4	154081323	splice site	probably null
R1531:Trp73	UTSW	4	154063895	missense	probably benign	0.31
R2002:Trp73	UTSW	4	154081445	missense	probably damaging	1.00
R2185:Trp73	UTSW	4	154104817	critical splice donor site	probably null
R3965:Trp73	UTSW	4	154062036	missense	probably benign	0.03
R3966:Trp73	UTSW	4	154062036	missense	probably benign	0.03
R4247:Trp73	UTSW	4	154064632	splice site	probably null
R4595:Trp73	UTSW	4	154064417	missense	probably damaging	0.99
R5170:Trp73	UTSW	4	154104838	missense	possibly damaging	0.95
R5260:Trp73	UTSW	4	154062602	missense	possibly damaging	0.48
R5622:Trp73	UTSW	4	154060592	missense	possibly damaging	0.68
R6173:Trp73	UTSW	4	154104341	missense	probably damaging	1.00
R6252:Trp73	UTSW	4	154064397	missense	probably damaging	1.00
R6950:Trp73	UTSW	4	154062053	missense	probably benign	0.18
R7050:Trp73	UTSW	4	154081442	missense	probably damaging	1.00
R7052:Trp73	UTSW	4	154064683	missense	probably damaging	0.98
R7620:Trp73	UTSW	4	154059257	nonsense	probably null
R8086:Trp73	UTSW	4	154116595	missense	unknown
Z1176:Trp73	UTSW	4	154067012	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAGGTCATATAACTATACCTCGC -3'
(R):5'- ATGAGGGTTGCACAGCTCTG -3'

Sequencing Primer
(F):5'- CTCGCTATATAGCTGAGGCGAG -3'
(R):5'- GTTGCACAGCTCTGAGCCTTG -3'

Posted On

2019-06-21