Incidental Mutation 'R7188:Jph4'
ID559450
Institutional Source Beutler Lab
Gene Symbol Jph4
Ensembl Gene ENSMUSG00000022208
Gene Namejunctophilin 4
SynonymsJPHL1, JP-4, 9330157P13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R7188 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55106826-55116935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55115207 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 23 (R23L)
Ref Sequence ENSEMBL: ENSMUSP00000022819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022819] [ENSMUST00000124493]
Predicted Effect probably damaging
Transcript: ENSMUST00000022819
AA Change: R23L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022819
Gene: ENSMUSG00000022208
AA Change: R23L

DomainStartEndE-ValueType
MORN 13 34 1.63e0 SMART
MORN 59 80 1.62e-1 SMART
MORN 104 125 4.76e-2 SMART
MORN 127 148 5.26e-4 SMART
low complexity region 170 180 N/A INTRINSIC
low complexity region 216 246 N/A INTRINSIC
MORN 280 301 1.37e-2 SMART
MORN 303 324 3.29e-5 SMART
low complexity region 367 406 N/A INTRINSIC
low complexity region 453 467 N/A INTRINSIC
low complexity region 528 553 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124493
AA Change: R23L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121893
Gene: ENSMUSG00000022208
AA Change: R23L

DomainStartEndE-ValueType
MORN 13 34 1.63e0 SMART
MORN 59 80 1.62e-1 SMART
MORN 104 125 4.76e-2 SMART
MORN 127 148 5.26e-4 SMART
low complexity region 170 180 N/A INTRINSIC
low complexity region 216 246 N/A INTRINSIC
MORN 280 301 1.37e-2 SMART
MORN 303 324 3.29e-5 SMART
low complexity region 367 406 N/A INTRINSIC
low complexity region 453 467 N/A INTRINSIC
low complexity region 528 553 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the junctophilin family of transmembrane proteins that are involved in the formation of the junctional membrane complexes between the plasma membrane and the endoplasmic/sarcoplasmic reticulum in excitable cells. The encoded protein contains a conserved N-terminal repeat region called the membrane occupation and recognition nexus sequence that is found in other members of the junctophilin family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,950,013 T1624S probably benign Het
Abca17 T C 17: 24,335,626 Y118C possibly damaging Het
Abcb6 A G 1: 75,174,137 probably null Het
Acox2 T A 14: 8,252,996 I236L possibly damaging Het
Adamts12 A T 15: 11,336,325 K1499* probably null Het
Ankrd24 G T 10: 81,636,390 E20* probably null Het
Arsa A T 15: 89,475,627 Y32* probably null Het
Atp9b A G 18: 80,917,826 S57P Het
Atr G T 9: 95,862,791 E54* probably null Het
Bace1 A G 9: 45,856,095 D192G probably benign Het
Cacna1d T C 14: 30,089,833 S1309G probably benign Het
Cd177 G T 7: 24,756,647 T232K probably damaging Het
Chil4 T A 3: 106,204,159 D213V probably damaging Het
Cmya5 A T 13: 93,046,038 I3538N probably damaging Het
Cyp26a1 T A 19: 37,699,305 M287K possibly damaging Het
Dcaf5 T C 12: 80,399,958 D129G probably damaging Het
Dnah12 A C 14: 26,814,413 K2095N probably benign Het
Dnpep G A 1: 75,316,057 S106L probably damaging Het
Dock2 C T 11: 34,239,675 E1499K possibly damaging Het
Dus4l A G 12: 31,646,715 F88L probably damaging Het
Fcrls A C 3: 87,259,523 D54E probably benign Het
Fign T A 2: 63,979,606 H440L possibly damaging Het
Gabpa A G 16: 84,846,286 D157G probably damaging Het
Gapdh T A 6: 125,165,440 probably benign Het
Gbp8 G T 5: 105,016,215 R406S probably benign Het
Gm15922 A T 7: 3,738,829 V184E probably damaging Het
Gm21775 A G Y: 10,553,894 R148G possibly damaging Het
Gm28363 G A 1: 117,698,849 V6I unknown Het
Gmps A G 3: 64,011,561 D522G probably damaging Het
Gpr75 T C 11: 30,892,687 S531P probably damaging Het
Hars2 G T 18: 36,790,561 E468D probably benign Het
Kctd12 T A 14: 102,981,794 Y216F probably benign Het
L3mbtl1 G A 2: 162,949,540 probably null Het
Lama4 G A 10: 38,965,733 probably benign Het
Lyst T A 13: 13,752,090 S3494T possibly damaging Het
Mybpc2 A G 7: 44,506,193 S879P probably benign Het
Ncaph C T 2: 127,122,114 V304M probably benign Het
Noto A T 6: 85,428,065 I229F possibly damaging Het
Olfr1061 T A 2: 86,413,351 K234* probably null Het
Olfr1209 T C 2: 88,909,859 D178G probably damaging Het
Olfr964-ps1 T C 9: 39,686,435 M170V unknown Het
Pald1 A T 10: 61,347,066 V368E probably damaging Het
Pde9a T A 17: 31,459,097 M217K probably damaging Het
Pitpnm2 G T 5: 124,121,303 A1323E probably benign Het
Ppp1r32 T A 19: 10,482,338 M2L probably benign Het
Ppp1r3a T C 6: 14,719,191 S575G probably benign Het
Prok1 T C 3: 107,239,625 I9V probably benign Het
Ptprc A T 1: 138,071,180 V905D probably damaging Het
Rbm25 G T 12: 83,663,998 G295V unknown Het
Rreb1 T C 13: 37,916,568 M225T possibly damaging Het
Ryr3 T C 2: 113,028,644 K55E probably damaging Het
Scgb2b26 G T 7: 33,944,954 T4K probably damaging Het
Setx C A 2: 29,148,172 D1556E probably benign Het
Sft2d1 C T 17: 8,323,332 T136I possibly damaging Het
Sirt5 C T 13: 43,371,904 A63V possibly damaging Het
Skor2 A G 18: 76,859,809 T409A possibly damaging Het
Slc12a6 T C 2: 112,334,415 M153T probably benign Het
Slc17a2 A G 13: 23,822,365 Y458C probably damaging Het
Slc36a2 A G 11: 55,162,657 V385A possibly damaging Het
St6galnac5 A T 3: 152,846,494 H145Q probably damaging Het
Tal1 T A 4: 115,068,413 N226K probably damaging Het
Tgtp2 G C 11: 49,059,308 R146G probably damaging Het
Uhrf1bp1l T C 10: 89,779,882 V129A probably damaging Het
Usp6nl T C 2: 6,440,519 S436P probably benign Het
Utp3 A G 5: 88,554,762 E50G probably benign Het
Zfp12 A T 5: 143,239,994 Q19L probably damaging Het
Other mutations in Jph4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0108:Jph4 UTSW 14 55109300 missense probably benign 0.43
R0142:Jph4 UTSW 14 55108326 missense probably benign 0.23
R0332:Jph4 UTSW 14 55114010 missense possibly damaging 0.61
R1610:Jph4 UTSW 14 55114103 missense probably damaging 0.99
R1829:Jph4 UTSW 14 55114911 missense probably damaging 0.99
R1912:Jph4 UTSW 14 55108361 missense probably benign 0.38
R2157:Jph4 UTSW 14 55113527 missense probably benign 0.01
R4073:Jph4 UTSW 14 55115040 missense probably benign 0.00
R4569:Jph4 UTSW 14 55115046 missense probably damaging 0.96
R4796:Jph4 UTSW 14 55109708 missense probably damaging 1.00
R6220:Jph4 UTSW 14 55110085 missense probably benign 0.05
R7314:Jph4 UTSW 14 55109739 unclassified probably benign
R7814:Jph4 UTSW 14 55109735 missense probably damaging 1.00
X0020:Jph4 UTSW 14 55114971 missense probably damaging 1.00
X0061:Jph4 UTSW 14 55113611 missense probably damaging 1.00
X0067:Jph4 UTSW 14 55109383 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCCATCCGAGTAGGTCTC -3'
(R):5'- AGCCACTCAGGATGAGGGTC -3'

Sequencing Primer
(F):5'- AAGCCGTCCTTCCAGAGC -3'
(R):5'- AGCCCCGGTCTAACTGC -3'
Posted On2019-06-26