Incidental Mutation 'R7188:Acox2'
ID559447
Institutional Source Beutler Lab
Gene Symbol Acox2
Ensembl Gene ENSMUSG00000021751
Gene Nameacyl-Coenzyme A oxidase 2, branched chain
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R7188 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location8225511-8259353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8252996 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 236 (I236L)
Ref Sequence ENSEMBL: ENSMUSP00000022271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022271] [ENSMUST00000164598] [ENSMUST00000170534]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022271
AA Change: I236L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022271
Gene: ENSMUSG00000021751
AA Change: I236L

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 1.2e-28 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 492 677 3.2e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164598
AA Change: I236L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126464
Gene: ENSMUSG00000021751
AA Change: I236L

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 6.3e-29 PFAM
Pfam:Acyl-CoA_dh_M 150 260 2.8e-11 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 495 675 1.3e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170534
SMART Domains Protein: ENSMUSP00000130543
Gene: ENSMUSG00000021751

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 4.1e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the acyl-CoA oxidase family. It encodes the branched-chain acyl-CoA oxidase which is involved in the degradation of long branched fatty acids and bile acid intermediates in peroxisomes. Deficiency of this enzyme results in the accumulation of branched fatty acids and bile acid intermediates, and may lead to Zellweger syndrome, severe mental retardation, and death in children. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice heterozygous for an endonuclease-mediated deletion exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,950,013 T1624S probably benign Het
Abca17 T C 17: 24,335,626 Y118C possibly damaging Het
Abcb6 A G 1: 75,174,137 probably null Het
Adamts12 A T 15: 11,336,325 K1499* probably null Het
Ankrd24 G T 10: 81,636,390 E20* probably null Het
Arsa A T 15: 89,475,627 Y32* probably null Het
Atp9b A G 18: 80,917,826 S57P Het
Atr G T 9: 95,862,791 E54* probably null Het
Bace1 A G 9: 45,856,095 D192G probably benign Het
Cacna1d T C 14: 30,089,833 S1309G probably benign Het
Cd177 G T 7: 24,756,647 T232K probably damaging Het
Chil4 T A 3: 106,204,159 D213V probably damaging Het
Cmya5 A T 13: 93,046,038 I3538N probably damaging Het
Cyp26a1 T A 19: 37,699,305 M287K possibly damaging Het
Dcaf5 T C 12: 80,399,958 D129G probably damaging Het
Dnah12 A C 14: 26,814,413 K2095N probably benign Het
Dnpep G A 1: 75,316,057 S106L probably damaging Het
Dock2 C T 11: 34,239,675 E1499K possibly damaging Het
Dus4l A G 12: 31,646,715 F88L probably damaging Het
Fcrls A C 3: 87,259,523 D54E probably benign Het
Fign T A 2: 63,979,606 H440L possibly damaging Het
Gabpa A G 16: 84,846,286 D157G probably damaging Het
Gapdh T A 6: 125,165,440 probably benign Het
Gbp8 G T 5: 105,016,215 R406S probably benign Het
Gm15922 A T 7: 3,738,829 V184E probably damaging Het
Gm21775 A G Y: 10,553,894 R148G possibly damaging Het
Gm28363 G A 1: 117,698,849 V6I unknown Het
Gmps A G 3: 64,011,561 D522G probably damaging Het
Gpr75 T C 11: 30,892,687 S531P probably damaging Het
Hars2 G T 18: 36,790,561 E468D probably benign Het
Jph4 C A 14: 55,115,207 R23L probably damaging Het
Kctd12 T A 14: 102,981,794 Y216F probably benign Het
L3mbtl1 G A 2: 162,949,540 probably null Het
Lama4 G A 10: 38,965,733 probably benign Het
Lyst T A 13: 13,752,090 S3494T possibly damaging Het
Mybpc2 A G 7: 44,506,193 S879P probably benign Het
Ncaph C T 2: 127,122,114 V304M probably benign Het
Noto A T 6: 85,428,065 I229F possibly damaging Het
Olfr1061 T A 2: 86,413,351 K234* probably null Het
Olfr1209 T C 2: 88,909,859 D178G probably damaging Het
Olfr964-ps1 T C 9: 39,686,435 M170V unknown Het
Pald1 A T 10: 61,347,066 V368E probably damaging Het
Pde9a T A 17: 31,459,097 M217K probably damaging Het
Pitpnm2 G T 5: 124,121,303 A1323E probably benign Het
Ppp1r32 T A 19: 10,482,338 M2L probably benign Het
Ppp1r3a T C 6: 14,719,191 S575G probably benign Het
Prok1 T C 3: 107,239,625 I9V probably benign Het
Ptprc A T 1: 138,071,180 V905D probably damaging Het
Rbm25 G T 12: 83,663,998 G295V unknown Het
Rreb1 T C 13: 37,916,568 M225T possibly damaging Het
Ryr3 T C 2: 113,028,644 K55E probably damaging Het
Scgb2b26 G T 7: 33,944,954 T4K probably damaging Het
Setx C A 2: 29,148,172 D1556E probably benign Het
Sft2d1 C T 17: 8,323,332 T136I possibly damaging Het
Sirt5 C T 13: 43,371,904 A63V possibly damaging Het
Skor2 A G 18: 76,859,809 T409A possibly damaging Het
Slc12a6 T C 2: 112,334,415 M153T probably benign Het
Slc17a2 A G 13: 23,822,365 Y458C probably damaging Het
Slc36a2 A G 11: 55,162,657 V385A possibly damaging Het
St6galnac5 A T 3: 152,846,494 H145Q probably damaging Het
Tal1 T A 4: 115,068,413 N226K probably damaging Het
Tgtp2 G C 11: 49,059,308 R146G probably damaging Het
Uhrf1bp1l T C 10: 89,779,882 V129A probably damaging Het
Usp6nl T C 2: 6,440,519 S436P probably benign Het
Utp3 A G 5: 88,554,762 E50G probably benign Het
Zfp12 A T 5: 143,239,994 Q19L probably damaging Het
Other mutations in Acox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Acox2 APN 14 8246363 missense probably damaging 1.00
IGL01845:Acox2 APN 14 8251617 missense probably damaging 1.00
IGL02830:Acox2 APN 14 8255298 missense probably damaging 1.00
R0415:Acox2 UTSW 14 8243835 splice site probably benign
R0535:Acox2 UTSW 14 8256753 missense probably damaging 1.00
R1424:Acox2 UTSW 14 8230247 missense probably benign 0.02
R1836:Acox2 UTSW 14 8248059 missense possibly damaging 0.91
R1862:Acox2 UTSW 14 8241416 missense probably benign 0.07
R1885:Acox2 UTSW 14 8248102 missense probably benign 0.00
R2032:Acox2 UTSW 14 8246400 missense probably benign 0.00
R2268:Acox2 UTSW 14 8253496 missense probably damaging 0.98
R2497:Acox2 UTSW 14 8251612 missense probably benign 0.00
R3032:Acox2 UTSW 14 8253466 missense probably damaging 1.00
R3842:Acox2 UTSW 14 8251543 missense probably damaging 1.00
R3874:Acox2 UTSW 14 8248061 missense probably benign 0.00
R4763:Acox2 UTSW 14 8241334 missense possibly damaging 0.81
R5072:Acox2 UTSW 14 8241374 nonsense probably null
R5397:Acox2 UTSW 14 8243803 missense probably benign 0.02
R5950:Acox2 UTSW 14 8255793 missense probably benign
R7208:Acox2 UTSW 14 8241303 missense probably benign 0.27
R7315:Acox2 UTSW 14 8256139 missense probably damaging 0.99
R7757:Acox2 UTSW 14 8230166 missense probably damaging 1.00
R7888:Acox2 UTSW 14 8246415 missense probably benign 0.00
R8269:Acox2 UTSW 14 8246325 missense probably benign 0.00
Z1177:Acox2 UTSW 14 8256852 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGCTGTGTAAAGGGAAAGTCC -3'
(R):5'- AGCTTGCTTACTGATGCCTGAG -3'

Sequencing Primer
(F):5'- AAAGTCCCCTTTCTAGGCAGTCTG -3'
(R):5'- ACTGATGCCTGAGTCACAGTATG -3'
Posted On2019-06-26