Incidental Mutation 'R7194:Nipal3'
ID559773
Institutional Source Beutler Lab
Gene Symbol Nipal3
Ensembl Gene ENSMUSG00000028803
Gene NameNIPA-like domain containing 3
Synonyms9130020G22Rik, Npal3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7194 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location135445420-135495038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135474421 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 152 (T152I)
Ref Sequence ENSEMBL: ENSMUSP00000101482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102549] [ENSMUST00000105856] [ENSMUST00000183807]
Predicted Effect probably benign
Transcript: ENSMUST00000102549
AA Change: T152I

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099608
Gene: ENSMUSG00000028803
AA Change: T152I

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 33 333 5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105856
AA Change: T152I

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101482
Gene: ENSMUSG00000028803
AA Change: T152I

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:Mg_trans_NIPA 35 330 9.5e-75 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000118178
Gene: ENSMUSG00000028803
AA Change: T11I

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 1 190 1.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183807
AA Change: T152I

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139088
Gene: ENSMUSG00000028803
AA Change: T152I

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 33 333 3.8e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit gender-dependent behavioral and immune system abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,164,775 E429D probably benign Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Aadat A G 8: 60,526,622 I173V probably benign Het
Abi3bp C T 16: 56,562,371 R115C probably damaging Het
Adam18 A G 8: 24,651,852 S234P possibly damaging Het
Adam20 A G 8: 40,796,412 R520G probably benign Het
Angel2 C G 1: 190,944,997 T514R probably damaging Het
Ankar A T 1: 72,659,033 I954N probably benign Het
Ankrd7 A T 6: 18,879,343 Y262F probably benign Het
Ano8 C A 8: 71,482,363 L398F possibly damaging Het
App C T 16: 85,025,431 V356I probably benign Het
Atp1a2 C A 1: 172,280,627 E636* probably null Het
Cckbr G A 7: 105,435,345 E429K possibly damaging Het
Cfi T G 3: 129,855,059 S197R probably damaging Het
Chn2 A G 6: 54,286,177 probably null Het
Col3a1 C A 1: 45,331,700 A405D unknown Het
Colec12 A T 18: 9,848,248 N142I probably benign Het
Copa T C 1: 172,119,944 L1109P probably damaging Het
Cpeb3 T A 19: 37,174,752 M75L probably benign Het
Cyp2d11 T C 15: 82,391,768 Y204C probably benign Het
Defa17 A G 8: 21,656,597 T80A probably benign Het
Dppa5a C T 9: 78,367,720 probably null Het
Fat4 G T 3: 38,888,884 S642I probably damaging Het
Fat4 T A 3: 38,983,895 C3899S probably damaging Het
Fn1 A G 1: 71,602,323 V1869A probably damaging Het
Gm10308 A T 17: 91,088,961 I104L unknown Het
Gm15448 A G 7: 3,824,793 W122R Het
Gpr139 C T 7: 119,144,673 A230T possibly damaging Het
Grm8 T C 6: 27,618,487 N452S probably benign Het
Hmox1 T C 8: 75,096,923 V73A probably benign Het
Hspa4 A G 11: 53,265,938 F641L probably damaging Het
Ifi207 T G 1: 173,729,924 H416P possibly damaging Het
Igkv10-96 G T 6: 68,632,044 T89K possibly damaging Het
Kmt2d A C 15: 98,843,833 V4482G unknown Het
Krt28 T A 11: 99,374,404 K146* probably null Het
Krt82 T C 15: 101,542,756 N406S probably damaging Het
Marveld3 A T 8: 109,959,845 probably null Het
Mllt6 C T 11: 97,673,568 S370L probably benign Het
Muc16 A G 9: 18,674,454 L26S unknown Het
Mup12 T A 4: 60,740,735 E48V probably benign Het
Myh1 G A 11: 67,211,357 V825I probably benign Het
Nrg3 A T 14: 39,472,478 M108K probably benign Het
Olfr961 G A 9: 39,647,091 V122I probably benign Het
Oog3 A T 4: 144,162,599 I3N probably damaging Het
Pkhd1l1 T C 15: 44,529,116 C1616R probably damaging Het
Ppa2 T A 3: 133,348,192 probably null Het
Ppfibp2 T A 7: 107,722,980 probably null Het
Ppp4c T C 7: 126,786,481 N229D probably damaging Het
Ptpn9 T C 9: 57,022,286 F96L probably damaging Het
Pygl A G 12: 70,194,320 V742A probably benign Het
Ranbp2 A G 10: 58,476,769 T1104A probably benign Het
Rasal1 G A 5: 120,675,492 A644T probably benign Het
Rcor3 T A 1: 192,125,961 T139S possibly damaging Het
Rfx5 T A 3: 94,955,143 I37N probably damaging Het
Rnf112 C T 11: 61,450,857 G374R probably damaging Het
Rrp12 T C 19: 41,871,540 I1034V probably benign Het
Sacs T A 14: 61,210,089 Y3195N possibly damaging Het
Scn4a A G 11: 106,324,236 I1243T probably benign Het
Sirt7 A T 11: 120,618,973 C362S probably benign Het
Slc17a6 T A 7: 51,626,892 S130T probably damaging Het
Snrnp48 A C 13: 38,209,899 Y60S probably damaging Het
Syne1 T C 10: 5,110,859 E7260G probably damaging Het
Trbv15 C T 6: 41,141,595 T95I probably benign Het
Trip12 A T 1: 84,794,222 N68K probably benign Het
Ugcg A G 4: 59,213,210 Y132C probably damaging Het
Usp9y A T Y: 1,304,672 C2391S probably damaging Het
Vmn1r103 C A 7: 20,510,513 V8L probably benign Het
Vmn2r15 T A 5: 109,292,783 N403I probably damaging Het
Zbtb11 T C 16: 56,007,188 S1006P probably damaging Het
Other mutations in Nipal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Nipal3 APN 4 135468593 missense possibly damaging 0.90
IGL01338:Nipal3 APN 4 135471883 critical splice donor site probably null
IGL02149:Nipal3 APN 4 135466852 missense possibly damaging 0.67
IGL02160:Nipal3 APN 4 135474417 nonsense probably null
IGL02560:Nipal3 APN 4 135479704 missense probably damaging 1.00
IGL02826:Nipal3 APN 4 135468550 nonsense probably null
IGL02868:Nipal3 APN 4 135466871 missense probably damaging 1.00
R0189:Nipal3 UTSW 4 135468518 missense possibly damaging 0.89
R0470:Nipal3 UTSW 4 135447372 missense probably damaging 0.99
R0891:Nipal3 UTSW 4 135468587 missense possibly damaging 0.91
R1633:Nipal3 UTSW 4 135447348 missense probably benign 0.03
R1686:Nipal3 UTSW 4 135447288 missense possibly damaging 0.49
R2921:Nipal3 UTSW 4 135477465 missense probably damaging 1.00
R2923:Nipal3 UTSW 4 135477465 missense probably damaging 1.00
R3732:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3732:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3733:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3734:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R5057:Nipal3 UTSW 4 135466856 missense probably damaging 1.00
R5616:Nipal3 UTSW 4 135452404 missense probably benign 0.01
R5758:Nipal3 UTSW 4 135452563 missense probably benign 0.02
R5779:Nipal3 UTSW 4 135452339 intron probably benign
R5885:Nipal3 UTSW 4 135471977 missense probably damaging 0.97
R6572:Nipal3 UTSW 4 135447253 missense probably benign 0.02
R6981:Nipal3 UTSW 4 135479547 missense probably damaging 1.00
R7537:Nipal3 UTSW 4 135490937 missense probably damaging 1.00
R8018:Nipal3 UTSW 4 135447348 missense possibly damaging 0.63
R8098:Nipal3 UTSW 4 135452398 missense possibly damaging 0.87
R8503:Nipal3 UTSW 4 135479581 missense probably damaging 1.00
X0066:Nipal3 UTSW 4 135447255 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGATCCCAACCGCTGGTC -3'
(R):5'- AGTAAGAGAACAATCTGTAAAACACA -3'

Sequencing Primer
(F):5'- CAACCGCTGGTCCCCTC -3'
(R):5'- CTTGCAGAGGACCTGGATTCAATC -3'
Posted On2019-06-26